Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.
Scanned 2/12/2026
Install via CLI
openskills install majiayu000/claude-skill-registry---name: crispr-offtarget-predictor
description: Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.
license: MIT
metadata:
author: BioKernel Team
version: "1.0.0"
compatibility:
- system: Python 3.9+
allowed-tools:
- run_shell_command
keywords:
- crispr-prediction
- automation
- biomedical
measurable_outcome: execute task with >95% success rate.
---"
# CRISPR Off-Target Predictor
This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.
## When to Use This Skill
* Designing new CRISPR experiments.
* Validating sgRNA specificity before synthesis.
* Analyzing potential safety risks in gene editing protocols.
## Core Capabilities
1. **Mismatch Scoring**: Calculates mismatch penalties for potential sites.
2. **PAM Validation**: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
3. **Risk Assessment**: Categorizes off-targets as Low, Medium, or High risk.
## Workflow
1. **Input**: sgRNA sequence (20nt) and PAM (e.g., NGG).
2. **Analysis**: Scans a reference library (mocked for this version) for similar sequences.
3. **Output**: List of potential off-targets with locations and risk scores.
## Example Usage
**User**: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."
**Agent Action**:
```bash
python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG
```
No comments yet. Be the first to comment!