End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.
Scanned 9/22/2026
Install to Claude Code
npx -y skills add peacezha/HPClaw --skill smrna-pipeline --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Smrna Pipeline?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/peacezha-smrna-pipeline)More formats (shields.io, HTML) on the badges page.
---
name: bio-workflows-smrna-pipeline
description: End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.
tool_type: mixed
primary_tool: miRDeep2
---
## Version Compatibility
Reference examples tested with: DESeq2 1.42+, cutadapt 4.4+
Before using code patterns, verify installed versions match. If versions differ:
- R: `packageVersion('<pkg>')` then `?function_name` to verify parameters
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Small RNA-seq Pipeline
**"Analyze my small RNA-seq data from FASTQ to differential miRNAs"** -> Orchestrate adapter trimming (cutadapt), miRNA quantification (miRDeep2/miRge3), novel miRNA discovery, differential expression (DESeq2), and target prediction (miRanda).
## Pipeline Overview
```
FASTQ -> cutadapt trim -> miRDeep2 -> Quantification -> DESeq2 -> Target prediction
```
## Step 1: Preprocessing
```bash
# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
--minimum-length 18 --maximum-length 30 \
-o trimmed.fastq.gz reads.fastq.gz
```
## Step 2: miRDeep2 Analysis
```bash
# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
-m -p genome_index -s reads_collapsed.fa \
-t reads_collapsed_vs_genome.arf
# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.fa
```
## Step 3: Differential Expression
```r
library(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)
```
## Step 4: Target Prediction
```bash
# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt
```
## QC Checkpoints
1. **After trimming**: Size distribution should peak at 21-23nt
2. **After alignment**: >70% mapping rate expected
3. **After DE**: Check volcano plot and PCA
## Related Skills
- small-rna-seq/mirdeep2-analysis - Detailed miRDeep2
- small-rna-seq/differential-mirna - DE analysis
- small-rna-seq/target-prediction - Target analysis
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!