Slice, extract, and concatenate biological sequences using Biopython. Use when extracting subsequences, joining sequences, or manipulating sequence regions by position.
Scanned 9/22/2026
Install to Claude Code
npx -y skills add peacezha/HPClaw --skill sequence-slicing --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Sequence Slicing?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/peacezha-sequence-slicing)More formats (shields.io, HTML) on the badges page.
---
name: bio-sequence-slicing
description: Slice, extract, and concatenate biological sequences using Biopython. Use when extracting subsequences, joining sequences, or manipulating sequence regions by position.
tool_type: python
primary_tool: Bio.Seq
---
## Version Compatibility
Reference examples tested with: BioPython 1.83+, samtools 1.19+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Sequence Slicing
Extract, slice, and concatenate sequences using Biopython's Seq objects.
**"Extract a subsequence"** -> Use Python slicing on Seq objects with 0-based half-open coordinates.
- Python: `seq[start:end]` (BioPython Seq)
**"Join exons into mRNA"** -> Extract multiple regions and concatenate them.
- Python: `sum((seq[s:e] for s, e in coords), Seq(''))` or `+` operator
## Required Import
```python
from Bio.Seq import Seq
```
## Core Operations
### Indexing (Single Position)
```python
seq = Seq('ATGCGATCG')
seq[0] # 'A' - first base (0-indexed)
seq[-1] # 'G' - last base
seq[3] # 'C' - fourth base
```
### Slicing (Extract Region)
```python
seq = Seq('ATGCGATCGATCG')
seq[0:3] # Seq('ATG') - first 3 bases
seq[3:6] # Seq('CGA') - positions 3-5
seq[:5] # Seq('ATGCG') - first 5
seq[-5:] # Seq('GATCG') - last 5
seq[::2] # Seq('AGGTGTG') - every 2nd base
seq[::-1] # Seq('GCTAGCTAGCGTA') - reversed
```
**Note:** Slicing returns a Seq object, not a string.
### Concatenation
```python
seq1 = Seq('ATGC')
seq2 = Seq('GGGG')
combined = seq1 + seq2 # Seq('ATGCGGGG')
```
Can also concatenate with strings:
```python
seq = Seq('ATGC')
extended = seq + 'NNNN' # Seq('ATGCNNNN')
```
## Code Patterns
### Extract CDS by Coordinates
```python
genome = Seq('NNNNATGCGATCGATCGTAANNN')
cds_start, cds_end = 4, 21
cds = genome[cds_start:cds_end]
```
### Extract with 1-Based Coordinates
Biology often uses 1-based coordinates. Convert to 0-based:
```python
def extract_1based(seq, start, end):
'''Extract using 1-based inclusive coordinates'''
return seq[start - 1:end]
genome = Seq('ATGCGATCGATCG')
region = extract_1based(genome, 1, 3) # Seq('ATG')
```
### Split Sequence into Codons
```python
def split_codons(seq):
return [seq[i:i+3] for i in range(0, len(seq) - len(seq) % 3, 3)]
seq = Seq('ATGCGATCGATCG')
codons = split_codons(seq) # [Seq('ATG'), Seq('CGA'), ...]
```
### Split into Fixed-Length Chunks
```python
def chunk_sequence(seq, size):
return [seq[i:i+size] for i in range(0, len(seq), size)]
seq = Seq('ATGCGATCGATCGATCGATCG')
chunks = chunk_sequence(seq, 10)
```
### Join Sequences with Linker
```python
seqs = [Seq('ATGC'), Seq('GGGG'), Seq('TTTT')]
linker = Seq('NNN')
joined = linker.join(seqs) # Seq('ATGCNNNGGGGNNTTTT')
```
Or manually:
```python
linker = 'NNN'
joined = Seq(linker.join(str(s) for s in seqs))
```
### Extract Multiple Regions
**Goal:** Splice non-contiguous regions (e.g., exons) into a single continuous sequence.
**Approach:** Extract each region by coordinates and concatenate with `+` or `sum()`.
```python
def extract_regions(seq, regions):
'''Extract and concatenate multiple regions'''
return sum((seq[start:end] for start, end in regions), Seq(''))
exon_coords = [(0, 50), (100, 150), (200, 250)]
mrna = extract_regions(genomic_seq, exon_coords)
```
### Extract Flanking Regions
```python
def get_flanking(seq, position, flank_size):
'''Get sequence around a position'''
start = max(0, position - flank_size)
end = min(len(seq), position + flank_size + 1)
return seq[start:end]
seq = Seq('ATGCGATCGATCGATCGATCG')
flanking = get_flanking(seq, 10, 5) # 5 bp on each side of position 10
```
### Tile Sequence into Overlapping Windows
```python
def sliding_windows(seq, window_size, step=1):
for i in range(0, len(seq) - window_size + 1, step):
yield seq[i:i + window_size]
seq = Seq('ATGCGATCGATCG')
for window in sliding_windows(seq, 5, 2):
print(window)
```
### Extract Feature from SeqRecord
```python
from Bio import SeqIO
for record in SeqIO.parse('sequence.gb', 'genbank'):
for feature in record.features:
if feature.type == 'CDS':
cds_seq = feature.extract(record.seq)
print(f'{feature.qualifiers.get("gene", ["?"])[0]}: {cds_seq[:30]}...')
```
### Create New SeqRecord from Slice
```python
from Bio.SeqRecord import SeqRecord
original = SeqRecord(Seq('ATGCGATCGATCGATCG'), id='full', description='Full sequence')
subset = SeqRecord(original.seq[5:15], id='subset', description=f'Positions 5-15 of {original.id}')
```
## Coordinate Systems
| System | Position 1 | Example |
|--------|------------|---------|
| 0-based (Python) | Index 0 | `seq[0:3]` gets positions 0, 1, 2 |
| 1-based (Biology) | Index 1 | Position 1-3 = `seq[0:3]` |
| 0-based half-open | Start inclusive, end exclusive | Standard Python slicing |
## Common Errors
| Error | Cause | Solution |
|-------|-------|----------|
| `IndexError` | Index out of range | Check sequence length first |
| Unexpected length | Off-by-one error | Remember end index is exclusive |
| Empty result | Start >= end | Check coordinate order |
| Wrong positions | 1-based vs 0-based confusion | Convert coordinates explicitly |
## Decision Tree
```
Need to extract or combine sequences?
├── Single position?
│ └── Use indexing: seq[i]
├── Contiguous region?
│ └── Use slicing: seq[start:end]
├── Multiple non-contiguous regions?
│ └── Extract each, concatenate with +
├── Join sequences?
│ ├── No linker: seq1 + seq2
│ └── With linker: linker.join(seqs)
├── Split into parts?
│ └── List comprehension with slicing
└── From GenBank features?
└── Use feature.extract(record.seq)
```
## Related Skills
- seq-objects - Create Seq and SeqRecord objects
- sequence-io/read-sequences - Parse GenBank files with features to extract
- transcription-translation - Translate extracted CDS regions
- alignment-files/sam-bam-basics - Extract sequences from BAM using samtools fasta/fastq
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!