Map N6-methyladenosine (m6A) RNA modifications at single-nucleotide resolution using miCLIP (Linder 2015), miCLIP2 + m6Aboost machine learning (Kortel 2021), GLORI (Liu 2023, antibody-free chemical conversion), DART-seq (Meyer 2019, APOBEC1-YTH fusion), m6Anet (nanopore direct RNA), or MeRIP-seq with calibration. Use when distinguishing antibody-based from antibody-free m6A detection methods, applying the DRACH motif constraint, reconciling cross-method disagreements (DART 44% in DRACH vs GLO...
Scanned 9/6/2026
Install to Claude Code
npx -y skills add GPTomics/bioSkills --skill m6a-clip --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of M6a Clip?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/gptomics-m6a-clip)More formats (shields.io, HTML) on the badges page.
---
name: bio-clip-seq-m6a-clip
description: Map N6-methyladenosine (m6A) RNA modifications at single-nucleotide resolution using miCLIP (Linder 2015), miCLIP2 + m6Aboost machine learning (Kortel 2021), GLORI (Liu 2023, antibody-free chemical conversion), DART-seq (Meyer 2019, APOBEC1-YTH fusion), m6Anet (nanopore direct RNA), or MeRIP-seq with calibration. Use when distinguishing antibody-based from antibody-free m6A detection methods, applying the DRACH motif constraint, reconciling cross-method disagreements (DART 44% in DRACH vs GLORI), or detecting m6Am at the cap.
tool_type: mixed
primary_tool: miCLIP2
---
## Version Compatibility
Reference examples tested with: miCLIP2 pipeline (Kortel 2021), m6Aboost 1.0+, GLORI-tools (Liu 2023), Bullseye 1.0+, m6Anet 2.1+, EpiNano 1.2+, MeRIPSeq tools (exomePeak2 1.16+), nanocompore 1.0+, samtools 1.19+, bedtools 2.31+, R 4.3+.
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- R: `packageVersion('<pkg>')` then `?function_name` to verify parameters
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws unexpected errors, introspect the installed package and adapt the example to match the actual API rather than retrying.
# m6A CLIP (N6-Methyladenosine Profiling)
**"Map m6A modifications at single-nucleotide resolution"** -> Profile m6A on RNA using one of three orthogonal approaches: antibody-based UV-CL (miCLIP/miCLIP2), antibody-free chemical conversion (GLORI), or enzyme-fusion editing (DART-seq with APOBEC1-YTH). Nanopore direct RNA (m6Anet, nanocompore, EpiNano) provides a fourth modality. The DRACH consensus motif (D=A/G/U, R=A/G, A=m6A, C=C, H=A/C/U) constrains plausible sites but is not exclusive - only a fraction of DRACH instances are methylated; some m6A sites occur outside DRACH. Cross-method discordance is real: only ~44% of DART-seq C->U mutations fall within DRACH motifs (Guo 2025 reanalysis of the DART-seq data), suggesting many DART sites are not consensus m6A. GLORI is the new (2023) gold standard for stoichiometric single-base m6A.
- CLI (miCLIP2 antibody-based): `iCount` or custom pipeline through truncation + C->T mutation analysis; then m6Aboost ML scoring
- CLI (GLORI antibody-free): `GLORI-tools` Python pipeline; output is per-A m6A fraction (stoichiometric)
- CLI (DART-seq editing): `Bullseye` or `SAILOR` pipeline; identify C->U editing sites; filter by DRACH; cross-check against APOBEC1-only control
- CLI (m6Anet nanopore): `m6anet inference` on nanopolish eventalign output; per-site probability of m6A
- CLI (MeRIP-seq peak calling): `exomePeak2` in R for peak-level m6A from IP+input MeRIP libraries
The m6A field is rapidly evolving (2022-2026); single-base methods (GLORI, m6Anet) have largely replaced antibody-based miCLIP for new studies, but miCLIP2 remains the most common because of its eCLIP-like processing pipeline. Cross-method discordance means high-confidence m6A reporting should require concordance across at least two orthogonal methods.
## Methods Taxonomy
| Method | Detection chemistry | Resolution | Antibody | Stoichiometry | Strength | Fails when |
|--------|---------------------|------------|----------|---------------|----------|------------|
| MeRIP-seq (Dominissini 2012, Meyer 2012) | Anti-m6A IP + RNA-seq | Peak (50-300 nt) | Yes | No | Original m6A method; widely used | Low resolution; cannot distinguish m6A from m6Am |
| miCLIP (Linder 2015) | Anti-m6A + UV-CL + RT mutation | Single-nucleotide (some) | Yes | No | Single-nt subset of m6A peaks | Low yield of single-nt; high false-positive rate |
| miCLIP2 (Kortel 2021) | Anti-m6A + UV-CL + improved library | Single-nucleotide | Yes | No | Higher complexity; ML-classified (m6Aboost) | Antibody specificity remains issue |
| GLORI (Liu 2023) | Glyoxal + nitrite deamination of unmodified A to inosine (reads as G) | Single-nucleotide | No (chemical) | Yes (stoichiometric) | Stoichiometric m6A fraction per site | New; less validated; harsh conversion may damage rare RNAs |
| DART-seq (Meyer 2019) | APOBEC1-YTH fusion edits C adjacent to m6A | Single-nucleotide (offset) | No | No | Antibody-free; in vivo | Only 44% of edits in DRACH motifs; high false positive |
| m6A-CLIP (Ke 2015) | Anti-m6A + UV-CL | Peak | Yes | No | Original UV-CL approach | Predecessor to miCLIP |
| m6Anet (Hendra 2022) | Nanopore direct RNA + neural net | Single-nucleotide (DRACH constraint) | No | Probability | Direct RNA; preserves isoform context | Restricted to DRACH; needs high coverage per site |
| EpiNano (Liu 2019) | Nanopore + SVM on signal features | Single-nucleotide | No | No | Pioneer nanopore m6A | Lower accuracy than m6Anet on benchmark |
| nanocompore (Leger 2021) | Nanopore + statistical test wt vs Mettl3-KO | Single-nucleotide | No | No | Comparative; high specificity | Requires KO control sample |
| DENA (Qin 2022) | Nanopore + neural network | Single-nucleotide | No | No | Single-sample tool | Newer; less validation |
| FTO/ALKBH5-aware methods | Eraser perturbation | Site | No | Indirect | Validates m6A regulation | Indirect |
| MAZTER-seq (Garcia-Campos 2019) | MazF (RNase) cleavage at unmodified ACA | Site (within ACA) | No | No | Antibody-free | Restricted to ACA context (subset of DRACH) |
| REF-seq (Zhang 2019) | MazF endonuclease-cleavage | Site | No | No | Antibody-free | Restricted context |
| m6ACali (Ye 2024) | Calibrates MeRIP | Site | NA | Yes (calibration) | Cross-method calibration | Postprocessing only |
Methodology evolves; verify the latest benchmark publications and reviews. The field is moving toward GLORI as the new gold standard but miCLIP2 remains the most-cited method because of its eCLIP-pipeline compatibility.
## Critical Choice: Antibody-Based vs Antibody-Free
**Antibody-based (MeRIP-seq, miCLIP, miCLIP2, m6A-CLIP):** Anti-m6A antibody (Abcam/Synaptic Systems) immunoprecipitates m6A-bearing RNA. The antibody is the only limitation - false positives from non-specific binding to long structured RNAs (especially poly-A) and false negatives at sites with low m6A stoichiometry. Mettl3 knockout calibration is recommended.
**Antibody-free chemical (GLORI):** Glyoxal + nitrite converts unmodified A to a nucleotide that reads as G; m6A is protected and reads as A. Sites are detected as A->G discrepancies post-conversion. Stoichiometric (the fraction of reads showing A vs G at a position = m6A fraction). Most rigorous but chemistry is harsh - degrades very long RNAs.
**Antibody-free enzymatic (DART-seq, APOBEC1-YTH):** APOBEC1 cytidine deaminase fused to YTH-domain (m6A reader) edits C residues adjacent to m6A. Editing pattern (C->U) marks m6A nearby but not exactly. 44% of DART edits in DRACH; many edits are off-target.
**Antibody-free nanopore (m6Anet, nanocompore, EpiNano):** Direct RNA sequencing detects m6A via current signal perturbation. Preserves isoform context. m6Anet has high AUC on HEK293T and outperforms EpiNano and Tombo on the Hendra 2022 benchmark.
| Goal | Method |
|------|--------|
| Stoichiometric m6A fraction per site | GLORI |
| eCLIP-compatible processing pipeline | miCLIP2 + m6Aboost |
| Isoform-resolved m6A | m6Anet (nanopore) |
| Cell-line comparison (KO available) | nanocompore vs Mettl3-KO |
| High-throughput screening | DART-seq (in vivo, no UV) |
| Initial discovery (low cost) | MeRIP-seq (with calibration) |
| Variants in m6A context | GLORI + variant-effect analysis |
| Combined m6A + 5'-cap m6Am | miCLIP2 (detects both with separate motifs) |
## DRACH Motif Constraint
The DRACH consensus (D=A/G/U, R=A/G, A=m6A, C=C, H=A/C/U) is the dominant motif at m6A sites - 70-90% of high-confidence sites fall in DRACH context. But:
- Some m6A sites occur outside DRACH (~10-20% in calibrated datasets)
- Many DRACH instances are NOT methylated (only a subset)
- Filtering for DRACH-only loses 10-20% of sites; not-filtering inflates false positives
**miCLIP2 + m6Aboost (Kortel 2021)** trained on Mettl3 knockout calibration data to score sites without DRACH filtering. The m6Aboost ML model is the recommended approach when DRACH-blind detection is needed.
**GLORI** does not filter by DRACH; the per-A m6A fraction is reported regardless of context. The non-DRACH GLORI sites (10-20%) include genuine m6A in non-canonical context.
## Cross-Method Discordance
| Comparison | Concordance | Source |
|------------|-------------|--------|
| miCLIP vs miCLIP2 | ~70% | Kortel 2021 |
| miCLIP2 vs GLORI | ~60% (miCLIP2 calls in GLORI) | Liu 2023 |
| GLORI vs MeRIP-seq peaks | ~50% sites in MeRIP peaks | Liu 2023 |
| DART-seq vs GLORI | ~44% of DART edits within DRACH | Guo 2025 |
| m6Anet vs miCLIP2 | ~75% concordance at high-coverage sites | Hendra 2022 |
| Antibody-based methods | High discordance between antibody lots | Practitioner reports |
**Reconciliation strategy:** Use GLORI as the new gold standard (2023+); cross-reference with m6Anet for nanopore isoform context; treat miCLIP2 + m6Aboost as a complementary in vivo perspective; treat DART-seq as a hypothesis-generating method. Three orthogonal methods agreeing on a site = high confidence.
## miCLIP2 Workflow
miCLIP2 (Kortel 2021) is the eCLIP-pipeline-compatible m6A method. It uses anti-m6A antibody + UV-CL + improved library prep that yields substantially higher-complexity libraries from less input than miCLIP.
**Goal:** Produce a high-confidence single-nucleotide m6A site BED from anti-m6A miCLIP2 reads with antibody-false-positive suppression via m6Aboost machine learning.
**Approach:** Run the eCLIP-style preprocessing + STAR + UMI-dedup pipeline, call single-nt CL sites with PureCLIP using SMInput control, then apply m6Aboost (trained on Mettl3-KO calibration data) to discriminate genuine m6A sites from antibody false positives without requiring strict DRACH motif filtering.
```bash
# Step 1: Preprocessing (eCLIP-style - see clip-seq/clip-preprocessing)
umi_tools extract --bc-pattern=NNNNNNNNNN \
--stdin=R1.fq.gz --read2-in=R2.fq.gz \
--stdout=R1.umi.fq.gz --read2-out=R2.umi.fq.gz
cutadapt -a AGATCGGAAGAGCACACGTCT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-q 6 -m 18 \
-o R1.trim.fq.gz -p R2.trim.fq.gz \
R1.umi.fq.gz R2.umi.fq.gz
# Step 2: Alignment (eCLIP-style)
STAR --runMode alignReads --genomeDir STAR_index \
--readFilesIn R1.trim.fq.gz R2.trim.fq.gz --readFilesCommand zcat \
--alignEndsType EndToEnd --outFilterMultimapNmax 1 --outFilterMismatchNoverReadLmax 0.04 \
--outSAMtype BAM SortedByCoordinate
umi_tools dedup --method=unique --paired -I aligned.bam -S dedup.bam
# Step 3: Single-nt CL site detection - PureCLIP or custom
pureclip -i dedup.bam -bai dedup.bam.bai -g genome.fa \
-ibam sminput.bam -ibai sminput.bam.bai \
-o miCLIP2_sites.bed -or miCLIP2_regions.bed -nt 8
# Step 4: m6Aboost ML scoring (Kortel 2021)
# Requires: site BED + features (sequence context, C->T rate, truncation position)
# Trained on Mettl3 KO calibration data
# Output: m6A probability score per site
python m6aboost.py \
--sites miCLIP2_sites.bed \
--bam dedup.bam \
--genome genome.fa \
--output m6Aboost_predictions.bed
# Step 5: Filter at m6Aboost score >= 0.5 (default; tune per study)
awk '$5 >= 0.5' m6Aboost_predictions.bed > m6a_high_confidence.bed
```
## GLORI Workflow (Antibody-Free Stoichiometric)
GLORI (Liu 2023) is the new (2023) gold-standard for stoichiometric m6A. Chemistry: glyoxal + nitrite converts unmodified A; m6A is protected.
```bash
# GLORI-tools pipeline (Liu lab, github). GLORI-tools is a multi-step Python pipeline
# (`run_GLORI.py` is the typical orchestrator); the conceptual flow below is illustrative --
# verify the exact CLI against the GLORI-tools repo before scripting.
# 1. Pre-conversion sequencing (control)
# 2. Post-conversion sequencing (treated)
# 3. GLORI-tools computes per-A m6A fraction
python run_GLORI.py \
--input pre_conversion.bam \
--treated post_conversion.bam \
--reference genome.fa \
--output glori_sites.tsv
# Output columns: chr, pos, strand, m6A_fraction, coverage, p_value
# m6A_fraction: 0.0 = unmodified; 1.0 = fully methylated
# Filter at coverage >= 20 and m6A_fraction >= 0.1
awk 'NR>1 && $5 >= 20 && $4 >= 0.1' glori_sites.tsv > glori_high_confidence.tsv
```
## DART-seq Workflow (Editing-Based)
DART-seq (Meyer 2019) expresses APOBEC1-YTH fusion in cells; the YTH domain binds m6A, APOBEC1 edits nearby Cs.
```bash
# Bullseye pipeline (Meyer lab github)
# Requires APOBEC1-only (no YTH) control to subtract off-target editing
Bullseye \
--ip dart_sample.bam \
--control apobec1_only.bam \
--reference genome.fa \
--output dart_sites.bed
# Filter for DRACH motif overlap (44% of DART sites are in DRACH)
# Sites outside DRACH may be off-target editing
bedtools intersect -wa -u -s -a dart_sites.bed -b drach_motifs.bed > dart_drach_sites.bed
```
## m6Anet Workflow (Nanopore)
m6Anet (Hendra 2022) is the leading nanopore direct-RNA m6A detector. Uses signal-level features in a multiple-instance learning framework.
```bash
# Step 1: nanopolish eventalign on raw nanopore signal
# (assumes basecalled FASTQ, aligned BAM, raw FAST5/POD5)
nanopolish eventalign \
--reads basecalled.fastq \
--bam aligned.bam \
--genome transcriptome.fa \
--scale-events --signal-index --samples \
> eventalign.tsv
# Step 2: m6Anet feature extraction
m6anet dataprep \
--eventalign eventalign.tsv \
--out_dir m6anet_features \
--n_processes 8
# Step 3: m6Anet inference
m6anet inference \
--input_dir m6anet_features \
--out_dir m6anet_out \
--pretrained_model HEK293T_RNA002
# Output: per-site probability of m6A
# Filter at probability_modified >= 0.9 (high confidence)
awk -F'\t' 'NR>1 && $5 >= 0.9' m6anet_out/data.indiv_proba.csv > m6Anet_high.tsv
```
## Per-Method Failure Modes
### miCLIP / miCLIP2 -- Antibody specificity
**Trigger:** Antibody lot variation; off-target binding to structured non-methylated RNAs.
**Mechanism:** Anti-m6A antibody (Abcam, Synaptic Systems) has variable specificity. Long structured RNAs (especially poly-A regions, snRNAs) capture non-specifically. False-positive rate without Mettl3-KO calibration is 30-50%.
**Symptom:** miCLIP sites overlap with snRNAs and long ncRNAs at unexpected rates; m6Aboost predicts < 30% of sites are true m6A.
**Fix:** Always include Mettl3-KO calibration (m6Aboost was trained on this). Apply m6Aboost ML; do not just filter by DRACH. Or switch to antibody-free GLORI.
### GLORI -- RNA degradation
**Trigger:** GLORI on long RNAs (> 5 kb); high glyoxal+nitrite concentration.
**Mechanism:** Harsh chemistry damages long RNAs; coverage at long transcripts drops 50-80% post-conversion.
**Symptom:** Long transcripts (e.g., Titin) have poor coverage post-GLORI; m6A sites in coding regions of long mRNAs under-called.
**Fix:** Use shorter conversion times for long-RNA studies (4 h vs 24 h); accept reduced power on long transcripts; cross-reference with miCLIP2 for long-RNA m6A.
### DART-seq -- Off-target editing
**Trigger:** APOBEC1-YTH expressed in cells; no APOBEC1-only control.
**Mechanism:** APOBEC1 has intrinsic C->U editing activity independent of YTH-m6A binding. Without APOBEC1-only control, 30-50% of edits are off-target.
**Symptom:** Many DART edits in non-DRACH context (~44% in DRACH); GO term enrichment of edited genes is non-specific.
**Fix:** Always run APOBEC1-only control in parallel; subtract its edits. Filter for DRACH motif overlap when reporting. Cross-validate with miCLIP2 or GLORI.
### m6Anet -- Coverage requirement
**Trigger:** Nanopore direct RNA on a low-input sample; per-site coverage < 20 reads.
**Mechanism:** m6Anet's multiple-instance learning needs >= 20 reads per DRACH position for stable probability estimate.
**Symptom:** Many "not enough coverage" sites in m6Anet output; gene-level coverage uneven.
**Fix:** Increase nanopore flowcell yield; pool replicates; restrict analysis to high-expression transcripts (TPM >= 5).
### MeRIP-seq -- Peak-level resolution
**Trigger:** MeRIP-seq on antibody-based platforms; peak width 100-300 nt.
**Mechanism:** MeRIP fragments are 100-300 nt; the peak captures a region containing m6A but cannot pinpoint the exact A.
**Symptom:** Peak BED width > 100 nt; downstream single-nt analysis impossible.
**Fix:** Combine MeRIP-seq with single-nt method (GLORI, miCLIP2). Or use m6ACali (Ye 2024) for cross-method calibration.
### DRACH-only filter -- Misses non-canonical m6A
**Trigger:** Filtered miCLIP2 / DART sites to DRACH-only.
**Mechanism:** 10-20% of validated m6A sites are outside DRACH context.
**Symptom:** Lost some validated sites; published m6A list shorter than expected.
**Fix:** Use m6Aboost (DRACH-blind ML) or GLORI (DRACH-blind chemical). Report both DRACH-filtered and unfiltered sets.
### Cross-method discordance frustration
**Trigger:** Three methods produce three different m6A site lists; user wants ONE truth.
**Mechanism:** Methods have different chemistries, sensitivities, and biases. They are not interchangeable. Discordance is real biology + technical.
**Symptom:** Two papers on the same RNA report different m6A sites.
**Fix:** Triangulate. Report (a) high-confidence sites from any single rigorous method (GLORI preferred); (b) consensus sites across 2+ methods. Acknowledge method limitations.
## Decision Tree by Use Case
| Scenario | Method | Why |
|----------|--------|-----|
| New 2024+ study, gold-standard single-base | GLORI | Stoichiometric, antibody-free |
| eCLIP-pipeline-compatible processing | miCLIP2 + m6Aboost | Uses eCLIP infrastructure |
| Isoform-resolved m6A | m6Anet (nanopore) | Long reads preserve isoforms |
| Mettl3 KO calibration available | miCLIP2 + m6Aboost; OR nanocompore | KO is the m6A negative control |
| In vivo, no UV | DART-seq | No UV CL needed |
| Initial discovery (low cost) | MeRIP-seq + exomePeak2 + m6ACali | Cheapest |
| Long RNAs (> 5 kb) | miCLIP2 or m6Anet (not GLORI) | GLORI degrades long RNAs |
| Variant in m6A context | GLORI single-base + variant-effect | Stoichiometric reveals dosage |
| m6Am at 5' cap | miCLIP2 (distinguishes via context) | The 5'-cap-adjacent A |
| Bacterial m6A | Custom methods | Mammalian DRACH irrelevant |
| Time-course m6A dynamics | GLORI per time point | Stoichiometric quantitation |
| Cross-species m6A | Use method validated in that species | Generalization not assumed |
## Reconciliation: When Methods Disagree
| Pattern | Likely cause | Action |
|---------|--------------|--------|
| miCLIP2 calls site; GLORI does not | Antibody false positive; or m6A fraction low | Trust GLORI for stoichiometry; flag miCLIP2 site for re-validation |
| GLORI calls site; miCLIP2 does not | Antibody false negative (saturation); or non-DRACH | Trust GLORI; check DRACH context of miCLIP2 site |
| DART edits not in DRACH | Off-target APOBEC1 editing | Subtract APOBEC1-only control; filter for DRACH |
| m6Anet calls site; miCLIP2 does not | Nanopore signal-specific detection; complementary | Cross-validate with GLORI; nanopore is orthogonal |
| MeRIP peak but no single-base call within | Peak captures multiple low-stoichiometry sites OR antibody non-specific | Use single-base method for confirmation |
| Discordance between antibody lots | Specificity variation | Use ENCODE-validated antibody; document lot |
| Cross-species method comparison | Method validated only in HEK293 / mouse | Re-validate before applying |
| Time-course shows decrease, methods disagree on magnitude | Stoichiometric (GLORI) vs fraction-based (miCLIP) | GLORI is quantitative; miCLIP is binary call |
**Operational rule for high-confidence m6A reporting:** (a) Use GLORI for stoichiometric single-base sites where chemistry permits; (b) Use miCLIP2 + m6Aboost where eCLIP-pipeline compatibility is required; (c) Use m6Anet for isoform-resolved or long RNAs; (d) Require concordance across at least two orthogonal methods for any m6A site claimed in publication.
## Common Errors
| Error / symptom | Cause | Solution |
|-----------------|-------|----------|
| miCLIP2 sites > 100k - more than realistic m6A count | No m6Aboost ML scoring | Apply m6Aboost; expect 10-50k high-confidence |
| GLORI coverage uneven across transcripts | Glyoxal harshness on long RNAs | Shorter conversion; or use other methods for long RNAs |
| DART edits everywhere | No APOBEC1-only subtraction | Add APOBEC1-only control |
| m6Anet returns "no sites" | Coverage < 20 per DRACH | Pool replicates; restrict to high-expression transcripts |
| 10-20% sites outside DRACH | Real biology + some false positives | Report DRACH and non-DRACH separately |
| MeRIP peaks > 200 nt wide | Method resolution | Use single-base method for single-nt sites |
| Different methods give different sites | Method-specific biases | Triangulate; cross-validate |
| Antibody lot variation in miCLIP | Specificity drift | Document lot; use Mettl3-KO calibration |
| m6Am detection failing in miCLIP2 | Failed at 5'-cap | Check 5'-cap adjacent context filter |
| Cross-method calibration confusing | m6ACali heuristic | Apply pre-publication; verify with m6Aboost |
## References
- Dominissini D et al 2012 Nature 485:201 (MeRIP-seq)
- Meyer KD et al 2012 Cell 149:1635 (MeRIP-seq concurrent)
- Linder B et al 2015 Nat Methods 12:767 (miCLIP)
- Ke S et al 2015 Genes Dev 29:2037 (m6A-CLIP)
- Kortel N et al 2021 Nucleic Acids Res 49:e92 (miCLIP2 + m6Aboost)
- Liu C et al 2023 Nat Biotechnol 41:355 (GLORI)
- Meyer KD 2019 Nat Methods 16:1275 (DART-seq)
- Guo W et al 2025 Mol Cell 85:1233 (single-molecule m6A; DART-seq DRACH reanalysis, 44% within DRACH)
- Hendra C et al 2022 Nat Methods 19:1590 (m6Anet)
- Liu H et al 2019 Nat Commun 10:4079 (EpiNano)
- Leger A et al 2021 Nat Commun 12:7198 (nanocompore)
- Garcia-Campos MA et al 2019 Cell 178:731 (MAZTER-seq)
- Qin H et al 2022 Genome Biol 23:25 (DENA)
- Zhang Z et al 2019 Sci Adv 5:eaax0250 (m6A-REF-seq)
- Ye H et al 2024 Nucleic Acids Res 52:4830 (m6ACali, MeRIP-seq calibration)
## Related Skills
- clip-seq/clip-preprocessing - miCLIP2 uses eCLIP-style preprocessing
- clip-seq/clip-alignment - miCLIP2 uses eCLIP-style alignment
- clip-seq/crosslink-site-detection - miCLIP2 single-nt CL detection
- clip-seq/clip-peak-calling - MeRIP-seq exomePeak2 peak calling
- clip-seq/stamp-antibody-free - STAMP / DART-seq antibody-free approach
- long-read-sequencing/nanopore-methylation - Native nanopore m6A
- long-read-sequencing/basecalling - dRNA-seq basecalling
- epitranscriptomics/m6a-peak-calling - MeRIP-specific peak calling
- epitranscriptomics/m6a-differential - Differential m6A
- epitranscriptomics/m6anet-analysis - Nanopore m6Anet workflow
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!