Pcr Primer Design

---
id: pcr-primer-design
name: PCR Primer Design
category: molecular_design
short-description: Design and validate primers for PCR, qPCR, TaqMan, and sequencing applications.
detailed-description: >
  Design optimized primers for various PCR applications (standard PCR, qPCR,
  TaqMan, multiplex, sequencing, SNP genotyping) with comprehensive validation
  pipeline. Includes Tm calculation, dimer analysis, secondary structure prediction,
  and specificity checking. Generates MIQE-compliant reports and multi-format
  exports (CSV, Excel, IDT ordering format). Use when you need primers for molecular
  biology applications with rigorous quality validation. Best for qPCR assays
  requiring MIQE 2.0 compliance, or any PCR application needing publication-quality
  documentation.
starting-prompt: Design qPCR primers for human GAPDH with MIQE compliance checking . .
---

# PCR Primer Design

Comprehensive PCR and qPCR primer design following MIQE 2.0 guidelines with automated validation.

## When to Use This Skill

Use this skill when you need:
- ✅ **qPCR primers** with MIQE 2.0 compliance for publication
- ✅ **Standard PCR primers** for cloning, genotyping, or amplification (100-1000 bp)
- ✅ **TaqMan probes** for probe-based qPCR assays
- ✅ **Rigorous validation** (specificity, dimers, secondary structures)
- ✅ **Publication-quality documentation** with comprehensive reports

**Choose application based on:**
- qPCR: 70-140 bp amplicons, strict Tm matching (±2°C), MIQE compliance
- Standard PCR: 100-1000 bp amplicons, general amplification
- TaqMan: Probe-based detection, fluorescent assays
- Multiplex: Multiple targets, compatible Tm requirements
- Sequencing: Single-direction primers, Sanger sequencing

**Don't use for:**
- ❌ In-situ hybridization probes → use specialized oligo design tools
- ❌ NGS library prep primers → use adapter design workflows
- ❌ CRISPR guide RNAs → use CRISPR-specific design tools

## Quick Start (Example)

Test this skill with a sample qPCR design in ~2 minutes:

```python
# Example: Design qPCR primers for a 700bp target sequence
from design_qpcr_primers import design_qpcr_primers

# Sample GAPDH sequence (700 bp, exon 3-4 region)
sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTTAACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATGTTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGAGCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAGAAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCCAAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACCCAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATCCCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGCATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAACAGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAAGACCCCTGGACCACCAGCCCCAGCAAGAGCACAAGAGGAAGAGAGAGACCCTCACTGCTGGGGAGTCCCTGCCACACTCAGTCCCCCACCACACTGAATCTCCCCTCCTCACAGTTGCCATGTAGACCCCTTGAAGAGGGGAGGGCTCTCTCTTCCTCTTGTGCTCTTGCTGGGGCTGGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACG"

primers = design_qpcr_primers(
    sequence=sequence,
    amplicon_size_range=(80, 120),
    num_return=5
)

print(f"Found {len(primers['primers'])} primer pairs")
print(f"MIQE-compliant: {sum(p.get('miqe_compliant', False) for p in primers['primers'])}")
```

**What you get:** 3-5 MIQE-compliant primer pairs, amplicons 80-120 bp, Tm matched within 2°C

**For your own data:** Follow Clarification Questions below to provide your sequence.

## Installation

**Core packages:**
```bash
pip install primer3-py biopython plotnine plotnine-prism pandas requests openpyxl
```

**Recommended:** Use virtual environment:
```bash
python -m venv pcr_env
source pcr_env/bin/activate  # Windows: pcr_env\Scripts\activate
pip install -r requirements.txt
```

### Software Requirements

| Software | Version | License | Commercial Use | Installation |
|----------|---------|---------|----------------|--------------|
| primer3-py | ≥2.0.0 | GPL v2 | ✅ Permitted* | `pip install primer3-py` |
| Biopython | ≥1.80 | BSD | ✅ Permitted | `pip install biopython` |
| plotnine | ≥0.12.0 | MIT | ✅ Permitted | `pip install plotnine` |
| plotnine-prism | latest | MIT | ✅ Permitted | `pip install plotnine-prism` |
| pandas | ≥1.5.0 | BSD | ✅ Permitted | `pip install pandas` |

*GPL v2 permits use in AI agent applications (execution, not distribution).

**NCBI API:** Primer-BLAST access is free. Rate limit: 3 requests/second (no API key) or 10/second (with free API key). See [references/primer_design_best_practices.md#ncbi-api-setup](references/primer_design_best_practices.md) for API key setup.

## Inputs

**Required:**
- **Target DNA sequence** in one of these formats:
  - FASTA file (local or uploaded)
  - GenBank/RefSeq accession (e.g., NM_002046)
  - Raw sequence (paste directly)
  - Gene name + organism (fetches from NCBI)

**Sequence requirements:**
- Minimum length: 150 bp (qPCR), 300 bp (standard PCR)
- Format: ATCG nucleotides (U converted to T)
- Quality: Avoid ambiguous bases (N) in primer regions

**Optional:**
- Regions to avoid (SNPs, repeats, splice sites)
- Custom parameter ranges (Tm, GC%, amplicon size)
- Organism/genome for specificity checking

**See [references/primer_design_best_practices.md#input-preparation](references/primer_design_best_practices.md) for sequence preparation guidelines.**

## Outputs

**Primary results:**
- **Primer sequences** with properties (Tm, GC%, length, position)
- **Validation report** (dimers, secondary structures, specificity)
- **Quality scores** and QC flags

**Export formats** (user-selectable):
- `primers.csv` - Spreadsheet-compatible table
- `primers.xlsx` - Excel with multiple sheets (design, validation, parameters)
- `primers.json` - Structured data for programmatic use
- `idt_order.txt` - IDT ordering format (copy-paste ready)
- `miqe_checklist.xlsx` - MIQE 2.0 compliance documentation (qPCR only)

**Visualizations** (optional):
- Primer binding site alignment (SVG, 300 DPI)
- Tm distribution plots
- Secondary structure diagrams

**See [references/code_examples.md#export-examples](references/code_examples.md#export-examples) for format details.**

## Clarification Questions

### 1. Input Sequence (ASK THIS FIRST)

Do you have a specific DNA sequence to design primers for?

- **Option A:** Upload FASTA file or provide file path
- **Option B:** Provide GenBank/RefSeq accession (e.g., NM_001256799)
- **Option C:** Provide gene name + organism (will fetch from NCBI)
- **Option D:** Paste sequence directly

**If uploaded:** Is this the complete target sequence or a specific region?

**Expected:** 150+ bp for qPCR, 300+ bp for standard PCR

### 2. PCR Application

What is your intended use for these primers?

- **qPCR (Quantitative PCR)** - Gene expression, 70-140 bp amplicons, MIQE-compliant
- **Standard PCR** - General amplification, cloning, genotyping, 100-1000 bp amplicons
- **TaqMan Assay** - Probe-based qPCR with fluorescent detection
- **Multiplex PCR** - Multiple targets simultaneously, compatible Tm required
- **Sequencing** - Sanger sequencing, single-direction primer
- **SNP Genotyping** - Allele-specific amplification

**Default:** qPCR (most common for gene expression studies)

### 3. Design Parameters

Do you want to use application-specific default parameters or customize?

- **Standard parameters** (recommended) - Optimized for selected application
- **Custom Tm range** - Specify melting temperature range (default: 58-62°C for qPCR)
- **Custom amplicon size** - Specify product size range
- **Custom GC range** - Adjust GC% (default: 40-60%)
- **Avoid regions** - Exclude specific sequences (SNPs, repeats, etc.)

**For qPCR:** Target exon-exon junction or ensure intron >1kb (MIQE guideline)?

**To understand design parameters:** See [references/parameter_ranges.md](references/parameter_ranges.md)

### 4. Validation Level

How thoroughly should primers be validated?

- **Basic** - Tm, GC%, dimer check (~1 min, sufficient for most uses)
- **Standard** - Basic + in-silico PCR (~2-3 min, recommended)
- **Complete** - Standard + NCBI Primer-BLAST (~5-10 min, publication-quality)
- **MIQE-compliant** - Complete + full documentation (qPCR only, ~10 min)

**Note:** NCBI Primer-BLAST requires internet and respects rate limits (slower but most thorough).

### 5. Output Requirements

What outputs do you need?

- **Export format:** CSV (default), Excel, JSON, IDT order format, or MIQE checklist
- **Report format:** Markdown (default), HTML, or text
- **Visualizations:** Generate primer alignment plots? (yes/no)
- **Number of primers:** How many primer pairs to return? (default: 5)

**For qPCR:** MIQE checklist is automatically generated.

## Standard Workflow

> **Note:** Run from the OmicsClaw root directory and add the workflow scripts to `sys.path`:
> ```python
> import sys; import os; sys.path.insert(0, os.path.abspath('knowledge_base/scripts/pcr-primer-design'))
> ```

🚨 **EXECUTE EXACTLY AS SHOWN - Do not modify these commands.**

**CRITICAL: Use relative paths (knowledge_base/scripts/pcr-primer-design/, references/). DO NOT construct absolute paths.**

### Step 1: Load Target Sequence

**Option A: Load from FASTA file**

```python
from Bio import SeqIO
record = SeqIO.read("your_sequence.fasta", "fasta")
sequence = str(record.seq)
```

**Option B: Load from GenBank accession**

See [references/code_examples.md#loading-sequences](references/code_examples.md#loading-sequences) for NCBI fetching code.

**Option C: Paste sequence directly**

```python
# For quick testing, paste your target sequence
sequence = "ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGG..."  # Your sequence here
```

### Step 2: Design Primers

**Choose based on application (from Clarification Question #2):**

**For qPCR (most common):**

```python
from design_qpcr_primers import design_qpcr_primers

primers = design_qpcr_primers(
    sequence=sequence,
    amplicon_size_range=(70, 140),  # MIQE guideline
    tm_match_threshold=2.0,
    num_return=5
)
```

**For Standard PCR:**

```python
from design_standard_primers import design_pcr_primers

primers = design_pcr_primers(
    sequence=sequence,
    amplicon_size_range=(100, 1000),
    tm_range=(55, 65),
    num_return=5
)
```

**For TaqMan Assay:**

```python
from design_taqman_probes import design_taqman_assay

assay = design_taqman_assay(
    sequence=sequence,
    probe_tm_offset=8.0,  # Probe Tm = primer Tm + 8°C
    num_return=5
)
```

**For custom parameters:** Read [references/parameter_ranges.md](references/parameter_ranges.md) and adapt ranges to your requirements.

### Step 3: Validate Primers

**Basic validation (recommended for all):**

```python
from check_dimers import analyze_dimers
from check_secondary_structures import analyze_secondary_structures

top_primer = primers['primers'][0]

# Check dimers
dimer_result = analyze_dimers(
    [top_primer['forward_seq'], top_primer['reverse_seq']],
    temperature=60.0
)

# Check secondary structures
fwd_structure = analyze_secondary_structures(top_primer['forward_seq'], 60.0)
rev_structure = analyze_secondary_structures(top_primer['reverse_seq'], 60.0)
```

**Complete validation (for publication):**

```python
from validate_specificity import in_silico_pcr

# In-silico PCR (fast)
products = in_silico_pcr(
    forward_primer=top_primer['forward_seq'],
    reverse_primer=top_primer['reverse_seq'],
    sequence=sequence
)

# For NCBI Primer-BLAST: See [references/code_examples.md#validation-examples](references/code_examples.md#validation-examples)
# Note: Requires internet, respects rate limits (3 req/sec)
```

⚠️ **CRITICAL - DO NOT:**
- ❌ Use absolute paths like `/mnt/knowhow/` → use relative paths `scripts/`
- ❌ Write inline primer design code → use provided scripts
- ❌ Skip dimer/structure checks → these catch common failures

### Step 4: Generate Reports and Export

```python
from generate_reports import generate_primer_report
from export_results import export_primers

# Generate report
report = generate_primer_report(
    primers=primers,
    validation_results={
        'dimers': dimer_result,
        'secondary_structures': {'forward': fwd_structure, 'reverse': rev_structure}
    },
    output_format="markdown",
    include_miqe_checklist=(application == 'qpcr')  # From Clarification Question #2
)

# Export in requested format(s)
export_primers(primers, format="csv", output_file="primers.csv")
export_primers(primers, format="excel", output_file="primers.xlsx")

# For qPCR: MIQE checklist
if application == 'qpcr':
    export_primers(primers, format="miqe_checklist", output_file="miqe_checklist.xlsx")
```

**For visualization plots:** See [references/code_examples.md#visualization](references/code_examples.md#visualization)

**That's it! The scripts handle all design and validation automatically.**

## Common Issues

| Issue | Likely Cause | Solution |
|-------|--------------|----------|
| **No primers found** | Target too short or constraints too strict | Relax Tm range (±5°C), widen GC range (35-65%), provide longer sequence (≥300 bp) |
| **High primer-dimer formation** | Complementary sequences, low Tm | Increase Tm to 60-62°C, redesign avoiding complementary regions |
| **Multiple off-target amplicons** | Low specificity, repetitive sequences | Move to unique region, increase primer length (22-25 nt), check specificity with BLAST |
| **Tm mismatch between primers** | Different GC content | Adjust primer lengths to balance Tm, use Primer3 penalty weights (see [references/parameter_ranges.md](references/parameter_ranges.md)) |
| **Poor qPCR efficiency** | Dimers, secondary structures, amplicon >150 bp | Redesign with shorter amplicon (70-120 bp), check for hairpins, verify no dimers |
| **NCBI API rate limit errors** | Too many requests too quickly | Wait 0.33 sec between requests, get free API key (10 req/sec), or use in-silico PCR first |
| **ImportError for scripts** | Missing `__init__.py` in scripts/ | Create empty `scripts/__init__.py` file to make it a Python package |

**For detailed troubleshooting:** See [references/troubleshooting_guide.md](references/troubleshooting_guide.md)

## Suggested Next Steps

After successful primer design:

1. **Order primers** - Use IDT order format export for direct ordering
2. **Optimize PCR conditions** - Test annealing temperature gradient (Tm ± 3°C)
3. **Validate experimentally**:
   - Test specificity (gel electrophoresis, melt curve for qPCR)
   - Optimize primer concentration (50-900 nM range)
   - Verify amplicon size (gel or bioanalyzer)
4. **For qPCR** - Perform standard curve, efficiency calculation, melt curve analysis
5. **Document** - Save MIQE checklist and validation reports for publication

**Related protocols:** See [references/primer_design_best_practices.md#experimental-validation](references/primer_design_best_practices.md#experimental-validation)

## Related Skills

- **qPCR Data Analysis** - Analyze qPCR Cq values after experimental validation
- **Sanger Sequencing Analysis** - Analyze results from sequencing primers
- **Gene Expression Normalization** - Choose reference genes for qPCR

## References

### Documentation
- [Primer Design Best Practices](references/primer_design_best_practices.md) - Comprehensive design guidelines
- [MIQE 2.0 Guidelines](references/miqe_guidelines.md) - qPCR standards and compliance
- [Parameter Ranges](references/parameter_ranges.md) - Recommended parameter values
- [Troubleshooting Guide](references/troubleshooting_guide.md) - Common issues and solutions
- [Code Examples](references/code_examples.md) - Complete code examples for all applications

### Key Publications
- **MIQE 2.0**: Bustin SA, et al. (2025) Clinical Chemistry 71(6):634-660
- **Primer3**: Untergasser A, et al. (2012) Nucleic Acids Research 40(15):e115
- **Primer-BLAST**: Ye J, et al. (2012) BMC Bioinformatics 13:134

### Online Resources
- NCBI Primer-BLAST: https://www.ncbi.nlm.nih.gov/tools/primer-blast/
- Primer3 Web: https://primer3.ut.ee/
- MIQE Guidelines: https://rdml.org/miqe.html