Preprocess CLIP-seq reads (eCLIP, iCLIP, iCLIP2, iCLIP3, irCLIP, PAR-CLIP, FLASH) with protocol-specific UMI extraction, adapter trimming, length filtering, and post-alignment PCR-duplicate collapse. Use when raw CLIP FASTQ must be turned into deduplicated, crosslink-preserving BAM input for peak calling; choosing between two-pass and single-pass adapter trimming; deciding minimum read length; or mapping UMI patterns to specific eCLIP/iCLIP/iCLIP2/iCLIP3 library preps.
Scanned 9/4/2026
Install to Claude Code
npx -y skills add gabrielmoreira/agent-skills-mirror --skill clip-preprocessing --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Clip Preprocessing?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/gabrielmoreira-clip-preprocessing)More formats (shields.io, HTML) on the badges page.
---
name: bio-clip-seq-clip-preprocessing
description: Preprocess CLIP-seq reads (eCLIP, iCLIP, iCLIP2, iCLIP3, irCLIP, PAR-CLIP, FLASH) with protocol-specific UMI extraction, adapter trimming, length filtering, and post-alignment PCR-duplicate collapse. Use when raw CLIP FASTQ must be turned into deduplicated, crosslink-preserving BAM input for peak calling; choosing between two-pass and single-pass adapter trimming; deciding minimum read length; or mapping UMI patterns to specific eCLIP/iCLIP/iCLIP2/iCLIP3 library preps.
tool_type: cli
primary_tool: umi_tools
---
## Version Compatibility
Reference examples tested with: umi_tools 1.1.5+, cutadapt 4.6+, fastp 0.23.4+, samtools 1.19+, pysam 0.22+, picard 3.1+, preseq 3.2+.
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
# CLIP-seq Preprocessing
**"Preprocess raw CLIP reads into UMI-deduplicated, alignable FASTQ"** -> Extract random barcodes, trim adapters without disturbing the 5' truncation site, length-filter to remove unmappable shorts, and (post-alignment) collapse PCR duplicates by UMI + position. The 5' end of the read carries the iCLIP/eCLIP truncation signature one base downstream of the protein-RNA crosslink; preserving this base is the single most important constraint of CLIP preprocessing.
- CLI (eCLIP, paired-end): `umi_tools extract --bc-pattern=NNNNNNNNNN --stdin R1.fq.gz --read2-in R2.fq.gz --stdout R1_umi.fq.gz --read2-out R2_umi.fq.gz`
- CLI (iCLIP/iCLIP2, single-end): `umi_tools extract --bc-pattern=NNNXXXXNN --extract-method=string --stdin R1.fq.gz --stdout R1_umi.fq.gz` (3+2 random Ns flanking a 4 nt library barcode; demultiplex by the X positions first if multiplexed)
- CLI (PAR-CLIP): `umi_tools extract --bc-pattern=NNNN ...` (most protocols use 4 nt random barcodes; verify the lab's exact prep)
- CLI (3' trim only, eCLIP convention): `cutadapt -a AGATCGGAAGAGCACACGTCT -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --quality-base 33 --quality-cutoff 6 -m 18 -o R1.trim.fq.gz -p R2.trim.fq.gz R1_umi.fq.gz R2_umi.fq.gz`
The eCLIP convention is: trim quality and adapter from the 3' end ONLY. The 5' end of read 2 (in paired-end eCLIP) is the truncation site of the RT enzyme at the protein-RNA adduct, located one nucleotide downstream of the crosslink. Trimming the 5' end discards that exact base. `cutadapt -g`, `fastp --trim_front1`, and aggressive quality trimming of the 5' end are all banned for CLIP unless a documented protocol-specific reason exists.
## Read Structure by Protocol
| Protocol | UMI length and location | Truncation-site read | Adapter set | Notes |
|----------|-------------------------|----------------------|-------------|-------|
| eCLIP (Van Nostrand 2016 / ENCODE) | 10 nt at R1 5' end (random nucleotides preceding insert) | R2 5' end (after R1 UMI is stripped) = crosslink -1 | Illumina TruSeq R1 + R2 + inline X1A/X1B inverted adapter for two-pass | ENCODE pipeline normative |
| seCLIP (single-end eCLIP) | 10 nt at R1 5' end | R1 5' end | TruSeq R1 only | ENCODE accepts both eCLIP and seCLIP |
| iCLIP (Konig 2010) | 5 nt random (NNNXXXXNN: 3 N + 4 X library barcode + 2 N), single-end | R1 5' end after barcode strip | L3 adapter at 3' | Multiplexed - demultiplex by the 4 X bases |
| iCLIP2 (Buchbender 2020) | 5 or 9 nt random (NNNXXXXNN or longer), single-end | R1 5' end | L3 adapter at 3' | Increased complexity vs iCLIP; same UMI pattern |
| iCLIP3 (Buchbender et al, bioRxiv 2026.03.01.708747) | 10 nt random + dual sample index, single-end | R1 5' end | TruSeq | Silica-column RNA isolation; non-radioactive; streamlined low-input protocol. Preprint - verify final published version before pinning a pipeline. |
| irCLIP (Zarnegar 2016) | 5 nt random + barcode (similar to iCLIP) | R1 5' end | IR700 adapter + standard TruSeq sequencing adapter | Infrared replaces 32P; otherwise iCLIP-like |
| PAR-CLIP (Hafner 2010) | 0-4 nt depending on prep | T->C transitions within reads (NOT a truncation method) | TruSeq R1 | UMI optional; rely on T->C signature for CL |
| FLASH (Aktas 2020) | Sample barcode + UMI in custom adapter | R1 5' | Custom L3 design | 1.5 day protocol; adapter design proprietary to MPI |
| miCLIP / miCLIP2 (Linder 2015 / Kortel 2021) | iCLIP-style barcodes | R1 5' = m6A -1 (truncation OR C-to-T) | iCLIP L3 | m6A-specific |
| STAMP (Brannan 2021) | NA (no UV) | NA (C-to-U editing) | 10x or bulk RNA-seq adapters | Antibody-free editing-based; preprocess as RNA-seq |
If the read structure differs from the lab's documentation, run `seqkit head -n 1000 R1.fq.gz | seqkit stats -a` and inspect the first 12 bases of 100 random reads. Random-barcode positions show ~25% base composition per position; library/sample barcodes will be fixed across reads.
## Critical Choice: One Adapter Pass vs Two
**One pass (single-end iCLIP, PAR-CLIP):** Single 3' adapter; cutadapt with `-a <L3>` and `-m 18` is sufficient.
**Two passes (eCLIP, paired-end):** The eCLIP library design ligates an inverted X1A/X1B inline adapter that can appear at either end of a short fragment due to read-through. The ENCODE pipeline does pass 1 with the standard 3' adapter, then pass 2 trims a residual 5' adapter that read-through events leave on read 2. Trimming a 5' adapter from R2 is a special case: cutadapt's `-G <ADAPTER>` (uppercase) anchored at R2's 5' end is the right invocation. Do NOT use `-g` (lowercase) for R1 5' trimming - that destroys the truncation site.
**Cutadapt full eCLIP-style invocation:**
```bash
# Pass 1 - 3' adapter (both reads)
cutadapt \
-a AGATCGGAAGAGCACACGTCT \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
--quality-base 33 -q 6 \
-m 18 \
-o R1.p1.fq.gz -p R2.p1.fq.gz \
R1.umi.fq.gz R2.umi.fq.gz
# Pass 2 - read-through 5' adapter on R2 only (ENCODE eCLIP)
cutadapt \
-G GATCGTCGGACTGTAGAACTCTGAAC \
--quality-base 33 -q 6 \
-m 18 \
-o R1.p2.fq.gz -p R2.p2.fq.gz \
R1.p1.fq.gz R2.p1.fq.gz
```
The `-q 6` is intentionally permissive. Aggressive `-q 20` quality trimming chews back the 5' end of R2 and breaks truncation-based crosslink-site detection. The `-m 18` minimum-length cutoff is non-negotiable: reads shorter than 18 nt are functionally unmappable (multi-map prevalence > 50%, see CIMS analysis discussions in the CLIP review literature) and must be discarded before alignment.
## Per-Protocol Failure Modes
### eCLIP -- 5' end trimmed by mistake
**Trigger:** Pipeline written for generic RNA-seq applied to eCLIP; `fastp` defaults trim both ends; `cutadapt -g` invoked on R2.
**Mechanism:** The 5' end of R2 in eCLIP is the truncation site = crosslink -1. Quality-trim from 5' or untargeted 5' adapter trim discards that exact base.
**Symptom:** Downstream PureCLIP / iCount / CTK CITS analysis fails to call crosslink sites; peak calling still works but the peaks lose nucleotide precision.
**Fix:** Use `-q 6` (3' only by default in cutadapt) and never `--trim_front2` in fastp. Validate by inspecting BAM read 2 5' positions: 60-90% of unique R2 5' positions should map within 100 nt windows around known RBP binding motifs, not be uniformly distributed.
### iCLIP / iCLIP2 -- Demultiplex confusion with UMI
**Trigger:** Multiplexed iCLIP library; user runs `umi_tools extract` with `NNNNNNNNN` (9 N) when the actual prep is `NNNXXXXNN` (5 random + 4 sample barcode).
**Mechanism:** umi_tools treats the entire 9-base prefix as UMI, losing the sample identity in the middle 4 bases. Reads from different samples are merged.
**Symptom:** Library complexity inflated artificially; per-sample read counts seem high but binding profiles look averaged across samples; sample-specific motifs absent.
**Fix:** Demultiplex BEFORE UMI extraction. Use `umi_tools extract --bc-pattern=NNNXXXXNN --extract-method=string --filter-cell-barcode` with a whitelist of the 4 X-base barcodes; or split the FASTQ with `je demultiplex` against the library barcode table first, then `umi_tools extract --bc-pattern=NNNNN` (the 5 surviving random Ns).
### PAR-CLIP -- T->C mistaken for sequencing error
**Trigger:** Standard variant-calling pipeline applied to PAR-CLIP without recognizing the T->C signature.
**Mechanism:** PAR-CLIP's diagnostic mutation is T->C (4SU adduct pairs with G during RT). Upon crosslinking the per-position T->C rate jumps from ~0.5% baseline to 20-50% (see PAR-CLIP literature; Hafner 2010, Spitzer 2014). Pipelines that filter "high-error" reads or apply STAR `--outFilterMismatchNoverLmax 0.04` (4% mismatch ceiling) discard the very reads carrying the signal.
**Symptom:** Loss of 40-70% of PAR-CLIP reads; downstream T->C site calling (PARalyzer, wavClusteR) finds almost nothing.
**Fix:** For PAR-CLIP only, raise the STAR mismatch ceiling to `--outFilterMismatchNoverLmax 0.07` (downstream in clip-alignment); also raise quality-trim tolerance in cutadapt to `-q 6` (already the CLIP default but worth re-confirming for PAR-CLIP). Track T->C rate per nucleotide position with `samtools mpileup` to confirm the signature is preserved post-alignment. **Critical exception summary:** iCLIP/eCLIP/iCLIP2 keep 0.04; PAR-CLIP only raises to 0.07. See clip-seq/clip-alignment for the alignment-stage override.
### Quality trimming too aggressive
**Trigger:** Inherited fastp/Trimmomatic pipeline with `-q 20` or `MINLEN 36`.
**Mechanism:** CLIP fragments are short (20-75 nt insert) and the 3' end carries adapter. Aggressive quality trimming and length filtering destroy 30-60% of usable reads.
**Symptom:** Per-replicate unique-mapped read count < 500k from a ~30M raw library; library complexity calculation crashes from too few reads.
**Fix:** Use `-q 6 -m 18` (cutadapt) or `--qualified_quality_phred 6 --length_required 18` (fastp). Compare retained fraction: a properly preprocessed CLIP library retains ~70-85% of raw reads through trimming.
### Library complexity below threshold
**Trigger:** PCR duplication rate >> 50%; deduplicated unique fragment count < 1M.
**Mechanism:** Low input cells (< 5M), over-amplification (> 25 PCR cycles), or failed IP all produce libraries dominated by a small number of PCR-amplified molecules.
**Symptom:** `preseq lc_extrap` predicts plateau well below 5M unique reads at infinite sequencing depth; `picard CollectLibraryComplexity` reports `ESTIMATED_LIBRARY_SIZE` < 1M; UMI families have median size > 8.
**Fix:** No analytic rescue. Re-prep the library with more input cells and fewer PCR cycles (target 14-18 cycles for eCLIP, 16-20 for iCLIP2). If the dataset must be salvaged, downsample to the unique-fragment fraction and acknowledge the loss of statistical power in differential analyses.
## UMI Deduplication Decision
After alignment, collapse PCR duplicates by `(UMI, position, strand)`. The choice between `unique` and `directional` methods is a precision/recall tradeoff:
| Method | Match rule | Behaviour | When to use |
|--------|-----------|-----------|-------------|
| `--method=unique` | Exact UMI match | Strictest; two UMIs differing by 1 base treated as independent molecules | ENCODE convention; reproducibility against published peaks |
| `--method=directional` | Network of UMIs differing by hamming-1; pick most-abundant | Collapses UMI sequencing errors; slightly fewer unique fragments reported | Highest precision; preferred when UMI sequencing error rate > 1% |
| `--method=cluster` | Connected components within edit distance | Most aggressive collapse | Default umi_tools behaviour pre-2017; not recommended for CLIP |
| `--method=adjacency` | Adjacency clustering | Between unique and directional | Rarely used for CLIP |
For eCLIP and iCLIP, the **ENCODE convention is `--method=unique`** (Van Nostrand 2016); the Yeo lab pipeline uses this exclusively. Directional adds 5-15 minutes runtime for human eCLIP at typical depth and is more conservative on rare UMI sequencing errors but produces slightly different absolute counts.
```bash
samtools index aligned.bam
umi_tools dedup \
--stdin=aligned.bam \
--stdout=dedup.bam \
--method=unique \
--paired \
--log=dedup.log
samtools index dedup.bam
```
Without UMIs (e.g., older eCLIP with only sample barcodes, some custom protocols), fall back to `picard MarkDuplicates --REMOVE_DUPLICATES true`. The trade-off: position-only dedup over-collapses (genuinely independent fragments that share start positions are lost) at ~5-15% in deep CLIP libraries; UMI dedup recovers them.
## Pre-Mapping rRNA Filter (Optional but Standard)
eCLIP libraries are 5-30% rRNA reads even after polyA depletion. ENCODE's pipeline pre-maps to a rRNA + RepeatMasked repeat index with bowtie2, then aligns unmapped reads to the genome. This is purely a performance optimization (avoiding STAR's multi-mapper tangle on rRNA) and does not change which reads survive deduplication; it only reorders the alignment stages.
```bash
# Pre-map to rRNA + repeats
bowtie2 -x repbase_repeats -U R1.trim.fq.gz \
--un-gz R1.norep.fq.gz \
-p 8 -S /dev/null
# Then align unmapped reads to genome with STAR
```
For non-eCLIP protocols (iCLIP, PAR-CLIP) the rRNA pre-map is optional; the alternative is to filter rRNA-overlapping reads after STAR alignment with `bedtools intersect -v -a aligned.bam -b rRNA.bed`.
## Library Complexity Assessment
```bash
# preseq lc_extrap predicts unique fragments at deeper sequencing
preseq lc_extrap -B -P aligned.bam -o complexity.txt
# Output: TOTAL_READS, EXPECTED_DISTINCT, LOWER_0.95CI, UPPER_0.95CI
# At 100M reads, EXPECTED_DISTINCT >= 10M = good complexity; < 3M = library failed
# picard direct estimate
picard EstimateLibraryComplexity \
I=aligned.bam \
O=picard_complexity.txt
# ESTIMATED_LIBRARY_SIZE > 5M = healthy
```
ENCODE eCLIP requires >= 1M unique fragments per replicate (after UMI dedup). Anything below 500k is functionally unusable for genome-wide peak calling. Between 500k and 1M, restrict analysis to high-expression transcripts.
## QC Checkpoints After Preprocessing
| Metric | Target | If below target |
|--------|--------|-----------------|
| Adapter trim retention | >= 70% reads | Adapter pattern wrong; recheck library prep docs |
| Mean read length post-trim | >= 25 nt | RNA fragmentation too aggressive in IP step |
| % reads >= 18 nt | >= 80% | Drop the prep; libraries with > 30% < 18 nt indicate degraded RNA |
| UMI-extract success rate | >= 95% | UMI pattern wrong; reads do not start with random Ns |
| PCR duplication rate | 30-70% (CLIP normal) | < 30% means under-sequenced; > 90% means over-amplified |
| Library complexity (preseq) | >= 1M unique at sequenced depth | Library failed; cannot rescue analytically |
CLIP libraries have HIGH duplication rates (40-70%) by design - the IP enriches a small pool of molecules. This is NOT a problem if UMIs collapse duplicates correctly. A "30% duplication rate" CLIP library typically means either (a) the IP failed (no enrichment, so library looks like RNA-seq) or (b) the library was undersequenced and unique molecules dominate.
## Common Errors
| Error / symptom | Cause | Solution |
|-----------------|-------|----------|
| umi_tools extract: "Read does not match pattern" for > 10% of reads | UMI pattern wrong (5 vs 9 vs 10 nt) | Inspect first 12 bases of 100 reads; rerun extract with correct `--bc-pattern` |
| cutadapt: 95% reads "Too short, filtered" | Adapter sequence wrong; reads are adapter-only after trim | Verify adapter sequence in library prep documentation; check both R1 and R2 adapters |
| All reads aligning to chrM after preprocessing | Pre-map to rRNA skipped; rRNA reads dominate | Add bowtie2 rRNA pre-map OR `samtools view -F 4 -L exclude_chrM_rRNA.bed` post-align |
| umi_tools dedup very slow (> 4h on 30M BAM) | Default `--method=directional` on dense libraries | Switch to `--method=unique` (ENCODE convention) |
| eCLIP truncation positions look uniform across genome | 5' adapter trim destroyed R2 5' end | Re-preprocess; `-g` should never touch R2 5' in eCLIP |
| 30% T->C mismatches in PAR-CLIP fail mapping | STAR mismatch ceiling 0.04 too strict | Raise to `--outFilterMismatchNoverLmax 0.07` for PAR-CLIP only |
| iCLIP2 reads after dedup << expected unique | Demultiplex done with whole UMI; samples merged | Demultiplex by 4 X bases of NNNXXXXNN first, then extract UMI |
## Reconciliation: Preprocessing Tools
| Pattern | Likely cause | Action |
|---------|--------------|--------|
| fastp gives more reads than cutadapt | fastp default polyG trimming kept short reads; cutadapt min-length filtered them | Both correct; pick one and document |
| umi_tools and je-suite give different dedup counts | Different UMI distance metric (unique vs hamming-1 vs network) | Use ENCODE convention `umi_tools --method=unique` for cross-study comparability |
| Library complexity (preseq) vs (picard) disagree | preseq extrapolates non-linearly; picard estimates at sequenced depth only | Trust preseq at sequenced depth, picard for absolute library size |
| Read count after Yeo lab pipeline >> nf-core/clipseq | Yeo includes rRNA reads; nf-core pre-filters | Both correct; downstream peak callers handle this differently |
**Operational rule:** For ENCODE comparability, follow the Yeo lab eCLIP pipeline exactly: `umi_tools extract` (10 N R1) -> `cutadapt -q 6 -m 18` (two-pass) -> `bowtie2 pre-map rRNA` (unmapped to genome) -> `STAR --alignEndsType EndToEnd --outFilterMultimapNmax 1` -> `umi_tools dedup --method=unique`. For iCLIP/iCLIP2, follow the iCount preprocessing tutorial. Document any deviation in methods.
## References
- Van Nostrand EL et al 2016 Nat Methods 13:508 (eCLIP protocol, ENCODE standard)
- Konig J et al 2010 Nat Struct Mol Biol 17:909 (original iCLIP, truncation principle)
- Buchbender A et al 2020 Methods 178:33 (iCLIP2 protocol, library complexity gain)
- Lee FCY et al 2021 bioRxiv 2021.08.27.457890 (iiCLIP / improved iCLIP, motif specificity)
- Hafner M et al 2010 Cell 141:129 (PAR-CLIP, 4SU labeling, T->C signature)
- Zarnegar BJ et al 2016 Nat Methods 13:489 (irCLIP, non-radioactive)
- Aktas T et al 2020 Nucleic Acids Res 48:e15 (FLASH, fast protocol)
- Smith T et al 2017 Genome Res 27:491 (UMI-tools, network-based dedup)
- Daley T & Smith AD 2013 Nat Methods 10:325 (preseq library complexity)
- Chakrabarti AM et al 2023 Genome Biol 24:235 (nf-core/clipseq pipeline)
## Related Skills
- clip-seq/clip-alignment - Downstream STAR/bowtie2 alignment with ENCODE parameters
- clip-seq/clip-qc - Library complexity, FRiP, IDR, read-distribution QC after preprocessing
- clip-seq/crosslink-site-detection - Why preserving the 5' R2 base is critical
- clip-seq/clip-peak-calling - Downstream peak callers consume the dedup BAM
- clip-seq/stamp-antibody-free - STAMP/DART-seq use RNA-seq preprocessing instead of UMI-based CLIP preprocessing
- read-qc/umi-processing - General UMI handling concepts
- read-qc/adapter-trimming - General adapter trimming
- alignment-files/duplicate-handling - Picard MarkDuplicates fallback when UMIs unavailable
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!