Skills DirectorySkills Directory
SkillsLearnSecurityCategoriesDocsCommunityBlog
Sign InSubmit Skill
Skills Directory

Security-tested agent skills for Claude, coding agents, and AI workflows.

Directory

  • Browse Skills
  • All Skills A–Z
  • Claude Skills
  • Claude Code Skills
  • Agent Skills
  • Categories
  • Submit a Skill

Learn

  • Learn Hub
  • Install Claude Skills
  • Write SKILL.md
  • Skills vs MCP
  • Directories Compared

Security

  • Security
  • Methodology
  • Secure Claude Skills
  • Security Badges

Company

  • About
  • Community
  • Blog
  • API Docs
  • Advertise

2026 Skills Directory. All rights reserved.

Back to skills

Bio Reverse Complement

ASecurity

--> --- name: bio-reverse-complement description: Generate reverse complements and complements of DNA/RNA sequences using Biopython. Use when working with opposite strands, primer design, or converting between template and coding strands. tool_type: python primary_tool: Bio.Seq measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command --- Generate complementary and reverse complementary sequences using Biopython.

2,984 stars
0 votes
0 copies
0 views
Added 5/29/2026
developmentpythonshell

Security Analysis

A100/100

Scanned 5/29/2026

Install to Claude Code

$npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-reverse-complement --agent claude-code

Installs into .claude/skills of the current project.

Are you the author of Bio Reverse Complement?

Add the live security badge to your README — it updates automatically with every re-scan.

Security grade badge for Bio Reverse Complement
[![Security: A — Skills Directory](https://www.skillsdirectory.com/api/skills/freedomintelligence-bio-reverse-complement/badge)](https://www.skillsdirectory.com/skills/freedomintelligence-bio-reverse-complement)

More formats (shields.io, HTML) on the badges page.

Download Zip
Files
SKILL.md
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA

-->

---
name: bio-reverse-complement
description: Generate reverse complements and complements of DNA/RNA sequences using Biopython. Use when working with opposite strands, primer design, or converting between template and coding strands.
tool_type: python
primary_tool: Bio.Seq
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
  - read_file
  - run_shell_command
---

# Reverse Complement

Generate complementary and reverse complementary sequences using Biopython.

## Required Import

```python
from Bio.Seq import Seq
```

## Core Methods

### reverse_complement()

Returns the reverse complement (5' to 3' of the opposite strand).

```python
seq = Seq('ATGCGATCG')
rc = seq.reverse_complement()  # Returns Seq('CGATCGCAT')
```

This is the most commonly used operation - it gives you the sequence of the opposite strand in the conventional 5' to 3' direction.

### complement()

Returns the complement without reversing.

```python
seq = Seq('ATGCGATCG')
comp = seq.complement()  # Returns Seq('TACGCTAGC')
```

Less commonly used - gives the opposite strand but in 3' to 5' direction.

### reverse_complement_rna()

For RNA sequences (uses U instead of T):

```python
rna = Seq('AUGCGAUCG')
rc_rna = rna.reverse_complement_rna()  # Returns Seq('CGAUCGCAU')
```

### complement_rna()

```python
rna = Seq('AUGCGAUCG')
comp_rna = rna.complement_rna()  # Returns Seq('UACGCUAGC')
```

## Base Pairing Rules

### DNA

| Base | Complement |
|------|------------|
| A | T |
| T | A |
| G | C |
| C | G |

### RNA

| Base | Complement |
|------|------------|
| A | U |
| U | A |
| G | C |
| C | G |

### Ambiguous Bases (IUPAC)

| Code | Bases | Complement |
|------|-------|------------|
| R | A/G | Y |
| Y | C/T | R |
| S | G/C | S |
| W | A/T | W |
| K | G/T | M |
| M | A/C | K |
| B | C/G/T | V |
| D | A/G/T | H |
| H | A/C/T | D |
| V | A/C/G | B |
| N | A/C/G/T | N |

Biopython handles IUPAC ambiguity codes correctly.

## Code Patterns

### Basic Reverse Complement

```python
seq = Seq('ATGCGATCGATCG')
rc = seq.reverse_complement()
print(f'Original: 5\'-{seq}-3\'')
print(f'RevComp:  5\'-{rc}-3\'')
```

### Visualize Double-Stranded DNA

```python
def show_dsdna(seq):
    comp = seq.complement()
    print(f"5'-{seq}-3'")
    print(f"   {'|' * len(seq)}")
    print(f"3'-{comp}-5'")

seq = Seq('ATGCGATCG')
show_dsdna(seq)
```

### Check if Sequence is Palindrome (Self-Complementary)

```python
def is_palindrome(seq):
    return seq == seq.reverse_complement()

seq1 = Seq('GAATTC')  # EcoRI site - palindrome
seq2 = Seq('ATGCGA')  # Not a palindrome
print(f'GAATTC is palindrome: {is_palindrome(seq1)}')
print(f'ATGCGA is palindrome: {is_palindrome(seq2)}')
```

### Reverse Complement a FASTA File

```python
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord

def reverse_complement_records(records):
    for record in records:
        rc_record = SeqRecord(
            record.seq.reverse_complement(),
            id=record.id + '_rc',
            description=record.description + ' reverse complement'
        )
        yield rc_record

records = SeqIO.parse('sequences.fasta', 'fasta')
rc_records = reverse_complement_records(records)
SeqIO.write(rc_records, 'sequences_rc.fasta', 'fasta')
```

### Primer Design Helper

```python
def design_primer_pair(template, start, end):
    '''Design forward and reverse primers for a region'''
    forward = template[start:start + 20]
    reverse = template[end - 20:end].reverse_complement()
    return forward, reverse

template = Seq('ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG')
fwd, rev = design_primer_pair(template, 0, 40)
print(f'Forward primer (5\'-3\'): {fwd}')
print(f'Reverse primer (5\'-3\'): {rev}')
```

### Handle Both Strands in Analysis

```python
def search_both_strands(seq, motif):
    '''Search for a motif on both strands'''
    motif = Seq(motif)
    results = []
    pos = seq.find(motif)
    while pos != -1:
        results.append(('+', pos))
        pos = seq.find(motif, pos + 1)
    rc = seq.reverse_complement()
    pos = rc.find(motif)
    while pos != -1:
        results.append(('-', len(seq) - pos - len(motif)))
        pos = rc.find(motif, pos + 1)
    return results

seq = Seq('ATGCGAATTCGATCGATGAATTCGATC')
hits = search_both_strands(seq, 'GAATTC')
for strand, pos in hits:
    print(f'Found on {strand} strand at position {pos}')
```

## Common Use Cases

| Task | Method |
|------|--------|
| Get opposite strand | `reverse_complement()` |
| Primer for opposite strand | `reverse_complement()` of target region |
| Template strand from coding | `reverse_complement()` |
| Check palindrome | `seq == seq.reverse_complement()` |
| Search both strands | Search original and reverse_complement |

## Common Errors

| Error | Cause | Solution |
|-------|-------|----------|
| Wrong bases in result | Mixing DNA/RNA methods | Use `reverse_complement_rna()` for RNA |
| `TypeError` | Passing string instead of Seq | Wrap in `Seq()` first |

## Decision Tree

```
Need to work with strand orientation?
├── Get opposite strand sequence (5' to 3')?
│   └── Use reverse_complement()
├── Get base-paired sequence (same direction)?
│   └── Use complement()
├── Working with RNA?
│   └── Use reverse_complement_rna()
├── Check if restriction site (palindrome)?
│   └── seq == seq.reverse_complement()
└── Designing primers?
    └── Reverse primer = reverse_complement() of 3' end
```

## Related Skills

- seq-objects - Create Seq objects to complement
- transcription-translation - Six-frame translation uses reverse complement
- motif-search - Search both strands for motifs
- restriction-analysis/restriction-sites - Restriction sites are often palindromic
- alignment-files/sam-bam-basics - BAM FLAG indicates read strand; use samtools view -f 16 for reverse


<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->

Attribution

FreedomIntelligenceFreedomIntelligence
View sourceMore from FreedomIntelligence →
SSkills DirectorySkills Directory

Your tool, in front of Claude Code builders.

3 founder slots · $299/mo · GSC-verified traffic · sponsors can never buy grades.

See placements

Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.

Comments (0)

No comments yet. Be the first to comment!

SSkills DirectorySkills Directory

Your tool, in front of Claude Code builders.

3 founder slots · $299/mo · GSC-verified traffic · sponsors can never buy grades.

See placements

Related Skills

Browser Extension Developer

Use this skill when developing or maintaining browser extension code in the `browser/` directory, including Chrome/Firefox/Edge compatibility, content scripts, background scripts, or i18n updates.

281612 votes

Seo Optimizer

SEO optimization with keyword analysis, readability assessment, technical validation, content quality. Use for search rankings, blog posts, content audits, or encountering keyword density, readability scores, meta tags, schema markup errors.

2132 votes

Google Official Seo Guide

Official Google SEO guide covering search optimization, best practices, Search Console, crawling, indexing, and improving website search visibility based on official Google documentation

1862 votes

Tanstack Start

Build a full-stack TanStack Start app on Cloudflare Workers from scratch — SSR, file-based routing, server functions, D1+Drizzle, better-auth, Tailwind v4+shadcn/ui. Use whenever the user mentions TanStack Start, asks to scaffold a full-stack Cloudflare app with SSR, wants an SSR dashboard, or asks for a React 19 + Cloudflare Workers app with file-based routing and server functions — even if they don't name TanStack Start specifically. No template repo — Claude generates every file fresh per ...

9881 votes

Pentest

PTES-aligned adversarial security audit for backend, frontend, and mobile applications. Produces a CVSS-scored Hacker Report with verified PoCs and phased remediation.

5491 votes
View all in development →