Generate reverse complements and complements of DNA/RNA sequences using Biopython. Use when working with opposite strands, primer design, or converting between template and coding strands.
Scanned 9/6/2026
Install to Claude Code
npx -y skills add swaruplab/operon --skill sequence-manipulation-reverse-complement --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Sequence Manipulation Reverse Complement?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/swaruplab-sequence-manipulation-reverse-complement)More formats (shields.io, HTML) on the badges page.
---
name: reverse-complement
description: Generate reverse complements and complements of DNA/RNA sequences using Biopython. Use when working with opposite strands, primer design, or converting between template and coding strands.
tool_type: python
primary_tool: Bio.Seq
---
## Version Compatibility
Reference examples tested with: BioPython 1.83+, samtools 1.19+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Reverse Complement
Generate complementary and reverse complementary sequences using Biopython.
**"Get the reverse complement"** -> Produce the 5'-to-3' sequence of the opposite strand.
- Python: `seq.reverse_complement()` (BioPython `Seq`)
- CLI: `samtools faidx ref.fa region --reverse-complement`
## Required Import
```python
from Bio.Seq import Seq
```
## Core Methods
### reverse_complement()
Returns the reverse complement (5' to 3' of the opposite strand).
```python
seq = Seq('ATGCGATCG')
rc = seq.reverse_complement() # Returns Seq('CGATCGCAT')
```
This is the most commonly used operation - it produces the sequence of the opposite strand in the conventional 5' to 3' direction.
### complement()
Returns the complement without reversing.
```python
seq = Seq('ATGCGATCG')
comp = seq.complement() # Returns Seq('TACGCTAGC')
```
Less commonly used - gives the opposite strand but in 3' to 5' direction.
### reverse_complement_rna()
For RNA sequences (uses U instead of T):
```python
rna = Seq('AUGCGAUCG')
rc_rna = rna.reverse_complement_rna() # Returns Seq('CGAUCGCAU')
```
### complement_rna()
```python
rna = Seq('AUGCGAUCG')
comp_rna = rna.complement_rna() # Returns Seq('UACGCUAGC')
```
## Base Pairing Rules
### DNA
| Base | Complement |
|------|------------|
| A | T |
| T | A |
| G | C |
| C | G |
### RNA
| Base | Complement |
|------|------------|
| A | U |
| U | A |
| G | C |
| C | G |
### Ambiguous Bases (IUPAC)
| Code | Bases | Complement |
|------|-------|------------|
| R | A/G | Y |
| Y | C/T | R |
| S | G/C | S |
| W | A/T | W |
| K | G/T | M |
| M | A/C | K |
| B | C/G/T | V |
| D | A/G/T | H |
| H | A/C/T | D |
| V | A/C/G | B |
| N | A/C/G/T | N |
Biopython handles IUPAC ambiguity codes correctly.
## Code Patterns
### Basic Reverse Complement
```python
seq = Seq('ATGCGATCGATCG')
rc = seq.reverse_complement()
print(f'Original: 5\'-{seq}-3\'')
print(f'RevComp: 5\'-{rc}-3\'')
```
### Visualize Double-Stranded DNA
```python
def show_dsdna(seq):
comp = seq.complement()
print(f"5'-{seq}-3'")
print(f" {'|' * len(seq)}")
print(f"3'-{comp}-5'")
seq = Seq('ATGCGATCG')
show_dsdna(seq)
```
### Check if Sequence is Palindrome (Self-Complementary)
```python
def is_palindrome(seq):
return seq == seq.reverse_complement()
seq1 = Seq('GAATTC') # EcoRI site - palindrome
seq2 = Seq('ATGCGA') # Not a palindrome
print(f'GAATTC is palindrome: {is_palindrome(seq1)}')
print(f'ATGCGA is palindrome: {is_palindrome(seq2)}')
```
### Reverse Complement a FASTA File
**Goal:** Produce a new FASTA file with all sequences reverse-complemented.
**Approach:** Parse records, create new SeqRecords with `.reverse_complement()`, write to output.
```python
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
def reverse_complement_records(records):
for record in records:
yield SeqRecord(
record.seq.reverse_complement(),
id=record.id + '_rc',
description=record.description + ' reverse complement'
)
records = SeqIO.parse('sequences.fasta', 'fasta')
SeqIO.write(reverse_complement_records(records), 'sequences_rc.fasta', 'fasta')
```
### Primer Design Helper
```python
def design_primer_pair(template, start, end):
'''Design forward and reverse primers for a region'''
forward = template[start:start + 20]
reverse = template[end - 20:end].reverse_complement()
return forward, reverse
template = Seq('ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG')
fwd, rev = design_primer_pair(template, 0, 40)
print(f'Forward primer (5\'-3\'): {fwd}')
print(f'Reverse primer (5\'-3\'): {rev}')
```
### Handle Both Strands in Analysis
**Goal:** Search for a motif on both DNA strands.
**Approach:** Search the forward sequence, then search its reverse complement. Convert positions on the reverse strand back to forward-strand coordinates.
```python
def search_both_strands(seq, motif):
'''Search for a motif on both strands'''
motif = Seq(motif)
results = []
pos = seq.find(motif)
while pos != -1:
results.append(('+', pos))
pos = seq.find(motif, pos + 1)
rc = seq.reverse_complement()
pos = rc.find(motif)
while pos != -1:
results.append(('-', len(seq) - pos - len(motif)))
pos = rc.find(motif, pos + 1)
return results
seq = Seq('ATGCGAATTCGATCGATGAATTCGATC')
hits = search_both_strands(seq, 'GAATTC')
for strand, pos in hits:
print(f'Found on {strand} strand at position {pos}')
```
## Common Use Cases
| Task | Method |
|------|--------|
| Get opposite strand | `reverse_complement()` |
| Primer for opposite strand | `reverse_complement()` of target region |
| Template strand from coding | `reverse_complement()` |
| Check palindrome | `seq == seq.reverse_complement()` |
| Search both strands | Search original and reverse_complement |
## Common Errors
| Error | Cause | Solution |
|-------|-------|----------|
| Wrong bases in result | Mixing DNA/RNA methods | Use `reverse_complement_rna()` for RNA |
| `TypeError` | Passing string instead of Seq | Wrap in `Seq()` first |
## Decision Tree
```
Need to work with strand orientation?
├── Get opposite strand sequence (5' to 3')?
│ └── Use reverse_complement()
├── Get base-paired sequence (same direction)?
│ └── Use complement()
├── Working with RNA?
│ └── Use reverse_complement_rna()
├── Check if restriction site (palindrome)?
│ └── seq == seq.reverse_complement()
└── Designing primers?
└── Reverse primer = reverse_complement() of 3' end
```
## Related Skills
- seq-objects - Create Seq objects to complement
- transcription-translation - Six-frame translation uses reverse complement
- motif-search - Search both strands for motifs
- restriction-analysis/restriction-sites - Restriction sites are often palindromic
- alignment-files/sam-bam-basics - BAM FLAG indicates read strand; use samtools view -f 16 for reverse
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!