All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
Scanned 9/6/2026
Install to Claude Code
npx -y skills add swaruplab/operon --skill read-qc-fastp-workflow --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Read Qc Fastp Workflow?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/swaruplab-read-qc-fastp-workflow)More formats (shields.io, HTML) on the badges page.
---
name: read-qc-fastp-workflow
description: All-in-one read preprocessing with fastp including adapter trimming, quality filtering, deduplication, base correction, and HTML report generation. Use when preprocessing Illumina data and wanting a single fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps.
tool_type: cli
primary_tool: fastp
---
## Version Compatibility
Reference examples tested with: FastQC 0.12+, fastp 0.23+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# fastp Workflow
All-in-one preprocessing tool that handles adapter trimming, quality filtering, deduplication, and report generation in a single pass.
**"Preprocess FASTQ reads with fastp"** -> Run adapter trimming, quality filtering, and QC reporting in a single pass.
- CLI: `fastp -i R1.fq -I R2.fq -o clean_R1.fq -O clean_R2.fq --html report.html`
## Basic Usage
### Single-End
```bash
fastp -i input.fastq.gz -o output.fastq.gz
```
### Paired-End
```bash
fastp -i R1.fastq.gz -I R2.fastq.gz -o R1_clean.fastq.gz -O R2_clean.fastq.gz
```
### With Custom HTML/JSON Reports
```bash
fastp -i R1.fq.gz -I R2.fq.gz \
-o R1_clean.fq.gz -O R2_clean.fq.gz \
-h sample_report.html \
-j sample_report.json
```
## Adapter Trimming
fastp auto-detects Illumina adapters by default.
```bash
# Auto-detect (default)
fastp -i in.fq -o out.fq
# Specify adapters manually
fastp -i in.fq -o out.fq \
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
# Paired-end with manual adapters
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
--adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
# Disable adapter trimming
fastp -i in.fq -o out.fq --disable_adapter_trimming
# Adapter FASTA file
fastp -i in.fq -o out.fq --adapter_fasta adapters.fa
```
## Quality Filtering
```bash
# Per-base quality threshold (default Q15)
fastp -i in.fq -o out.fq -q 20
# Mean read quality threshold
fastp -i in.fq -o out.fq -e 25
# Max unqualified bases percent (default 40)
fastp -i in.fq -o out.fq -q 20 --unqualified_percent_limit 30
# Disable quality filtering
fastp -i in.fq -o out.fq --disable_quality_filtering
```
## Quality Trimming
```bash
# Sliding window from 3' end (recommended)
fastp -i in.fq -o out.fq \
--cut_right \
--cut_right_window_size 4 \
--cut_right_mean_quality 20
# Sliding window from 5' end
fastp -i in.fq -o out.fq \
--cut_front \
--cut_front_window_size 4 \
--cut_front_mean_quality 20
# Both ends
fastp -i in.fq -o out.fq \
--cut_front --cut_tail \
--cut_front_window_size 4 \
--cut_front_mean_quality 20 \
--cut_tail_window_size 4 \
--cut_tail_mean_quality 20
```
## Length Filtering
```bash
# Minimum length (default 15)
fastp -i in.fq -o out.fq -l 36
# Maximum length
fastp -i in.fq -o out.fq --length_limit 150
# Required length (discard shorter AND longer)
fastp -i in.fq -o out.fq -l 100 --length_limit 100
```
## Poly-X Trimming
```bash
# Trim poly-G (NovaSeq/NextSeq artifacts) - auto-enabled for these platforms
fastp -i in.fq -o out.fq --trim_poly_g
# Disable poly-G trimming
fastp -i in.fq -o out.fq --disable_trim_poly_g
# Trim poly-X (any homopolymer)
fastp -i in.fq -o out.fq --trim_poly_x
# Custom poly-G minimum length (default 10)
fastp -i in.fq -o out.fq --trim_poly_g --poly_g_min_len 5
```
## N Base Handling
```bash
# Max N bases (default 5)
fastp -i in.fq -o out.fq -n 3
# Disable N filtering
fastp -i in.fq -o out.fq --n_base_limit 50
```
## Deduplication
```bash
# Enable deduplication
fastp -i in.fq -o out.fq --dedup
# Accuracy level (1-6, higher = more memory, default 3)
fastp -i in.fq -o out.fq --dedup --dup_calc_accuracy 4
```
## Base Correction (Paired-End Only)
```bash
# Enable overlap-based correction
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq --correction
# Required overlap length (default 30)
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--correction --overlap_len_require 20
```
## Paired-End Merge
```bash
# Merge overlapping paired reads
fastp -i R1.fq -I R2.fq \
--merge --merged_out merged.fq \
-o R1_unmerged.fq -O R2_unmerged.fq
```
## UMI Processing
```bash
# UMI in read (extract to header)
fastp -i in.fq -o out.fq \
--umi --umi_loc read1 --umi_len 8
# UMI in separate read
fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq \
--umi --umi_loc index1
# UMI locations: index1, index2, read1, read2, per_index, per_read
```
## Complete Workflow Example
### Standard Illumina Pipeline
```bash
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 36 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
```
### NovaSeq/NextSeq Pipeline
```bash
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--trim_poly_g \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 36 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
```
### RNA-seq Pipeline
```bash
fastp \
-i raw_R1.fastq.gz -I raw_R2.fastq.gz \
-o clean_R1.fastq.gz -O clean_R2.fastq.gz \
--detect_adapter_for_pe \
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20 \
-q 20 -l 50 \
--thread 8 \
-h sample_fastp.html -j sample_fastp.json
```
## Output Files
| File | Description |
|------|-------------|
| `*.html` | Interactive HTML report |
| `*.json` | Machine-readable statistics |
| Output FASTQ | Processed reads |
## JSON Report Structure
```python
import json
with open('sample_fastp.json') as f:
report = json.load(f)
summary = report['summary']
print(f"Total reads: {summary['before_filtering']['total_reads']}")
print(f"Passed reads: {summary['after_filtering']['total_reads']}")
print(f"Q20 rate: {summary['after_filtering']['q20_rate']:.2%}")
print(f"Q30 rate: {summary['after_filtering']['q30_rate']:.2%}")
```
## Performance
```bash
# Set threads (default 3)
fastp -i in.fq -o out.fq --thread 8
# Disable HTML report (faster)
fastp -i in.fq -o out.fq --html /dev/null
# Process from stdin
zcat in.fq.gz | fastp --stdin -o out.fq
```
## Related Skills
- quality-reports - MultiQC can aggregate fastp JSON reports
- adapter-trimming - Cutadapt for complex adapter scenarios
- quality-filtering - Trimmomatic alternative
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!