Predict RNA secondary structure, MFE folding, base-pair probabilities, RNA-RNA interactions via ViennaRNA Python bindings. Pipeline: sequence → MFE → partition function and pair-probability matrix → dot-bracket → duplex. Use for siRNA/sgRNA targeting, ribozyme design, RNA accessibility. Use RNAfold CLI for batch use without Python.
Scanned 9/12/2026
Install to Claude Code
npx -y skills add stanfish06/skillquarium --skill viennarna-structure-prediction --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Viennarna Structure Prediction?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/stanfish06-viennarna-structure-prediction)More formats (shields.io, HTML) on the badges page.
---
name: "viennarna-structure-prediction"
description: "Predict RNA secondary structure, MFE folding, base-pair probabilities, RNA-RNA interactions via ViennaRNA Python bindings. Pipeline: sequence → MFE → partition function and pair-probability matrix → dot-bracket → duplex. Use for siRNA/sgRNA targeting, ribozyme design, RNA accessibility. Use RNAfold CLI for batch use without Python."
license: "MIT"
---
# ViennaRNA Structure Prediction
## Overview
ViennaRNA is the gold-standard toolkit for RNA secondary structure prediction based on thermodynamic nearest-neighbor parameters. It predicts the minimum free energy (MFE) structure and dot-bracket notation for a given RNA sequence, computes the full partition function to obtain base pair probabilities, and models RNA-RNA interactions via co-folding and duplex prediction. The Python bindings (`import RNA`) expose the full ViennaRNA C library with sequence-level and fold-compound APIs. Command-line programs (`RNAfold`, `RNAalifold`, `RNAduplex`) are also available and demonstrated here.
## When to Use
- Predicting the minimum free energy secondary structure of an RNA sequence (mRNA, lncRNA, miRNA precursor, aptamer)
- Computing base pair probability matrices to assess structural uncertainty and identify well-defined stem-loops
- Designing or evaluating siRNA accessibility by folding the target mRNA region and checking for double-stranded structure
- Assessing sgRNA targeting efficiency by predicting guide RNA secondary structure that may reduce on-target activity
- Modeling RNA-RNA interactions (co-folding or duplex prediction) for miRNA-target binding or antisense oligonucleotide design
- Calculating folding free energies for a set of sequences to compare thermodynamic stability
- Use `mfold` (web server) or `RNAstructure` instead when you need Mfold algorithm predictions specifically or need the Efold partition function; ViennaRNA uses the Turner 2004 nearest-neighbor parameters and is the standard for research-grade thermodynamic prediction
## Prerequisites
- **Python packages**: `ViennaRNA` (Python bindings), `matplotlib`, `numpy`
- **Data requirements**: RNA sequences as strings (ACGU alphabet; T is auto-converted to U by ViennaRNA)
- **Environment**: Python 3.9+; conda installation strongly recommended (handles C library dependencies)
```bash
# Install via conda (recommended)
conda install -c conda-forge -c bioconda viennarna
# Verify installation
python -c "import RNA; print(RNA.__version__)"
# 2.7.2
# Install additional Python dependencies
pip install matplotlib numpy pandas
# Optional: verify CLI tools are available
RNAfold --version
# RNAfold 2.7.2
```
## Quick Start
```python
import RNA
# Predict MFE structure for an RNA sequence
sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"
structure, mfe = RNA.fold(sequence)
print(f"Sequence: {sequence}")
print(f"Structure: {structure}")
print(f"MFE: {mfe:.2f} kcal/mol")
# Sequence: GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA
# Structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
# MFE: -22.40 kcal/mol
```
## Workflow
### Step 1: Sequence Preparation and MFE Folding
Load an RNA sequence and compute its minimum free energy secondary structure using `RNA.fold()`. Validate the input and inspect the dot-bracket output.
```python
import RNA
def prepare_sequence(seq: str) -> str:
"""Normalize sequence: uppercase, replace T→U, validate alphabet."""
seq = seq.upper().replace("T", "U").strip()
invalid = set(seq) - set("ACGUNX")
if invalid:
raise ValueError(f"Invalid characters in sequence: {invalid}")
return seq
# E. coli tRNA-Phe (GenBank: M10217)
raw_seq = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"
sequence = prepare_sequence(raw_seq)
structure, mfe = RNA.fold(sequence)
print(f"Sequence length: {len(sequence)} nt")
print(f"Structure: {structure}")
print(f"MFE: {mfe:.2f} kcal/mol")
# Validate: structure length must equal sequence length
assert len(structure) == len(sequence), "Structure and sequence length mismatch"
# Count stems (paired bases)
n_paired = structure.count("(") + structure.count(")")
n_unpaired = structure.count(".")
print(f"Paired bases: {n_paired} | Unpaired bases: {n_unpaired}")
print(f"Stem fraction: {n_paired/len(sequence):.2f}")
```
### Step 2: Create a Fold Compound for Advanced Analysis
The `RNA.fold_compound` object is the central API for partition function, base pair probabilities, and constrained folding.
```python
import RNA
sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"
# Create fold compound (wraps the sequence with model parameters)
fc = RNA.fold_compound(sequence)
# Compute MFE structure via the fold compound API
structure, mfe = fc.mfe()
print(f"MFE structure: {structure}")
print(f"MFE: {mfe:.2f} kcal/mol")
# Evaluate free energy of an alternative structure
alt_structure = "." * len(sequence) # fully unfolded
energy = fc.eval_structure(alt_structure)
print(f"Fully unfolded energy: {energy:.2f} kcal/mol")
print(f"Folding stabilization: {energy - mfe:.2f} kcal/mol")
```
### Step 3: Partition Function and Base Pair Probabilities
Compute the thermodynamic partition function to obtain ensemble-level base pair probabilities. High-probability pairs indicate well-defined structural elements.
```python
import RNA
import numpy as np
sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"
n = len(sequence)
fc = RNA.fold_compound(sequence)
# Step 1: MFE folding — gives the mfe value used to rescale below
structure_mfe, mfe = fc.mfe()
# Step 2: Rescale Boltzmann factors for numerical stability (optional but recommended)
fc.exp_params_rescale(mfe)
# Step 3: Compute partition function
structure_pf, gibbs_free_energy = fc.pf()
print(f"Gibbs free energy (ensemble): {gibbs_free_energy:.2f} kcal/mol")
print(f"MFE structure: {structure_mfe}")
print(f"Pairing propensity (pf): {structure_pf}") # not the centroid; use fc.centroid() for that
# Step 4: Retrieve base pair probability matrix
bpp = fc.bpp() # returns (n+1)x(n+1) matrix; 1-indexed
# Convert to 0-indexed numpy array for analysis
probs = np.zeros((n, n))
for i in range(1, n + 1):
for j in range(i + 1, n + 1):
if bpp[i][j] > 0.0:
probs[i - 1][j - 1] = bpp[i][j]
probs[j - 1][i - 1] = bpp[i][j]
# Identify high-confidence pairs (p > 0.9)
high_conf = [(i, j, probs[i, j]) for i in range(n) for j in range(i + 1, n) if probs[i, j] > 0.9]
print(f"\nHigh-confidence base pairs (p > 0.9): {len(high_conf)}")
for i, j, p in high_conf[:5]:
print(f" {sequence[i]}{i+1} — {sequence[j]}{j+1}: p={p:.3f}")
```
### Step 4: Visualize Base Pair Probability Matrix
Plot the base pair probability matrix as a heatmap to visualize structural regions.
```python
import RNA
import numpy as np
import matplotlib.pyplot as plt
import matplotlib.colors as mcolors
sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"
n = len(sequence)
fc = RNA.fold_compound(sequence)
structure_mfe, mfe = fc.mfe()
fc.exp_params_rescale(mfe)
fc.pf()
bpp = fc.bpp()
# Build matrix
probs = np.zeros((n, n))
for i in range(1, n + 1):
for j in range(i + 1, n + 1):
if bpp[i][j] > 0.0:
probs[i - 1][j - 1] = bpp[i][j]
probs[j - 1][i - 1] = bpp[i][j]
fig, ax = plt.subplots(figsize=(8, 7))
im = ax.imshow(probs, cmap="hot_r", vmin=0, vmax=1, origin="upper", aspect="equal")
plt.colorbar(im, ax=ax, label="Base pair probability")
ax.set_xlabel("Nucleotide position")
ax.set_ylabel("Nucleotide position")
ax.set_title(f"Base Pair Probability Matrix\n(n={n} nt, MFE={mfe:.2f} kcal/mol)")
plt.tight_layout()
plt.savefig("bpp_matrix.png", dpi=150, bbox_inches="tight")
print("Saved: bpp_matrix.png")
```
### Step 5: RNA-RNA Duplex Prediction (Co-folding)
Use `RNA.cofold()` to predict the interaction between two RNA sequences by concatenating them with an `&` separator.
```python
import RNA
# miRNA (hsa-miR-21-5p) and its target sequence in mRNA (PTEN 3'UTR region)
mirna_seq = "UAGCUUAUCAGACUGAUGUUGA"
target_seq = "UCAACAUCAGUCUGAUAAGCUA" # approximate complementary target
# Co-fold: concatenate with & separator
cofold_seq = mirna_seq + "&" + target_seq
structure, mfe = RNA.cofold(cofold_seq)
print(f"miRNA: {mirna_seq}")
print(f"Target: {target_seq}")
print(f"Co-fold MFE: {mfe:.2f} kcal/mol")
# Parse the structure — RNA.cofold strips the & from its output
n1 = len(mirna_seq)
struct_mirna = structure[:n1]
struct_target = structure[n1:]
print(f"miRNA structure: {struct_mirna}")
print(f"Target structure: {struct_target}")
paired_in_duplex = struct_mirna.count("(") + struct_mirna.count(")")
print(f"Bases paired across the duplex: {paired_in_duplex}")
```
### Step 6: RNA Accessibility Analysis for siRNA Design
Compute the accessibility of a target region within a longer mRNA sequence — critical for siRNA and antisense oligonucleotide efficiency.
```python
import RNA
import numpy as np
def compute_accessibility(mrna_seq: str, window: int = 40) -> list:
"""
Compute per-position probability of being unpaired (accessible) using
a sliding-window approach on the partition function.
Returns list of (position, accessibility) tuples.
"""
n = len(mrna_seq)
fc = RNA.fold_compound(mrna_seq)
_, mfe = fc.mfe()
fc.exp_params_rescale(mfe)
fc.pf()
bpp = fc.bpp()
# Probability of being paired at each position
p_paired = np.zeros(n)
for i in range(1, n + 1):
for j in range(1, n + 1):
if i != j:
p = bpp[min(i,j)][max(i,j)]
p_paired[i - 1] += p
p_unpaired = 1.0 - np.clip(p_paired, 0, 1)
return p_unpaired
# Example: 80-nt mRNA segment with a known accessible region
mrna = "AUGCUAGCUAGCUAGCUAUGCUAGCUAGCUUUUUUUUUUUUAUGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGC"
p_unpaired = compute_accessibility(mrna)
import matplotlib.pyplot as plt
fig, ax = plt.subplots(figsize=(10, 3))
ax.bar(range(1, len(mrna) + 1), p_unpaired, color="#2166ac", alpha=0.8)
ax.axhline(0.5, color="red", lw=1, ls="--", label="50% unpaired")
ax.set_xlabel("Position (nt)")
ax.set_ylabel("P(unpaired)")
ax.set_title("RNA Accessibility Profile")
ax.legend()
plt.tight_layout()
plt.savefig("rna_accessibility.png", dpi=150, bbox_inches="tight")
print("Saved: rna_accessibility.png")
# Top 5 most accessible positions (siRNA target candidates)
best = sorted(enumerate(p_unpaired, 1), key=lambda x: -x[1])[:5]
print("\nMost accessible positions:")
for pos, prob in best:
print(f" Position {pos}: P(unpaired) = {prob:.3f} ({mrna[pos-1]})")
```
### Step 7: Command-Line RNAfold and Output Parsing
Use the `RNAfold` CLI for batch folding via subprocess, then parse the output.
```bash
# Fold a single sequence from stdin
echo "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" | RNAfold
# Output:
# GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA
# (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... (-22.40)
# Batch fold from FASTA file
RNAfold < sequences.fasta > structures.txt
# Generate base pair probability dot plot (PostScript)
RNAfold --noPS < sequences.fasta # suppress PostScript output
RNAfold -p < sequences.fasta # save dot plot as rna.ps
```
```python
# Python: run RNAfold via subprocess and parse output
import subprocess
import re
def run_rnafold(sequence: str) -> tuple:
"""Run RNAfold CLI and return (structure, mfe) tuple."""
result = subprocess.run(
["RNAfold", "--noPS"],
input=sequence,
capture_output=True, text=True, timeout=30
)
if result.returncode != 0:
raise RuntimeError(f"RNAfold failed: {result.stderr}")
lines = result.stdout.strip().split("\n")
# Last line: structure and energy, e.g. "((....)) (-5.40)"
match = re.match(r"^([.()\[\]{}<>|]+)\s+\((-?\d+\.\d+)\)$", lines[-1])
if not match:
raise ValueError(f"Could not parse RNAfold output: {lines[-1]}")
structure = match.group(1)
mfe = float(match.group(2))
return structure, mfe
sequences = [
("tRNA-Phe", "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"),
("miR-21", "UAGCUUAUCAGACUGAUGUUGA"),
]
for name, seq in sequences:
struct, mfe = run_rnafold(seq)
print(f"{name}: {mfe:.2f} kcal/mol | {struct}")
```
### Step 8: Constrained Folding and Suboptimal Structures
Apply hard constraints (force or forbid specific base pairs) and enumerate suboptimal structures.
```python
import RNA
sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"
# --- Constrained folding: force specific pairs ---
fc = RNA.fold_compound(sequence)
# Add hard constraint: force the closing pair of the acceptor stem
fc.hc_add_bp(1, 72) # force the pair between positions 1 and 72 (1-based)
structure_c, mfe_c = fc.mfe()
print(f"Constrained MFE: {mfe_c:.2f} kcal/mol")
print(f"Constrained struct: {structure_c}")
# --- Enumerate suboptimal structures (delta_mfe threshold) ---
fc_sub = RNA.fold_compound(sequence)
_, mfe_opt = fc_sub.mfe()
# Get suboptimal structures within 5 kcal/mol of MFE
delta = 5.0 # kcal/mol window
subopt_list = RNA.subopt(sequence, int(delta * 100)) # energy in 10-cal units
print(f"\nSuboptimal structures within {delta} kcal/mol of MFE:")
print(f"Total suboptimal structures: {len(subopt_list)}")
for s in subopt_list[:3]:
e = s.energy # already kcal/mol
print(f" {s.structure} ({e:.2f} kcal/mol)")
```
## Key Parameters
| Parameter | Default | Range / Options | Effect |
|-----------|---------|-----------------|--------|
| `sequence` (RNA.fold) | — | ACGU string | Input RNA sequence; T is auto-converted to U |
| `temperature` (model detail) | `37.0` °C | `0`–`100` °C | Folding temperature; lower temp stabilizes structures |
| `dangles` (model detail) | `2` | `0`, `1`, `2`, `3` | Dangling end treatment; 2=average, 0=none, use 2 for most applications |
| `noGU` (model detail) | `False` | `True`/`False` | Disallow G-U wobble pairs when True |
| `noLP` (model detail) | `False` | `True`/`False` | Disallow lonely base pairs (single-bp stems); reduces noise |
| `delta` (RNA.subopt) | — | float kcal/mol | Energy window above MFE for suboptimal structure enumeration |
| `window` (sliding window) | — | int nt | Sliding window size for long-sequence accessibility analysis |
## Common Recipes
### Recipe: Batch MFE Folding from a FASTA File
When to use: Fold a library of RNA sequences (e.g., candidate aptamers, guide RNAs) and compare energies.
```python
import RNA
from pathlib import Path
def read_fasta(fasta_path: str) -> list:
"""Parse FASTA file, return list of (name, sequence) tuples."""
records = []
name, seq = None, []
for line in Path(fasta_path).read_text().splitlines():
if line.startswith(">"):
if name:
records.append((name, "".join(seq).upper().replace("T", "U")))
name, seq = line[1:].split()[0], []
else:
seq.append(line.strip())
if name:
records.append((name, "".join(seq).upper().replace("T", "U")))
return records
# Example: fold sequences from a FASTA file
sequences = [
("aptamer_1", "GGGUUUUGAAACUAAACUAGGCUCUAGCGCUGGUGUCCCUUCCCGGCUCUAGCCUCAGCAGAAGCUUGAAAAAACCC"),
("aptamer_2", "GGGAGACAAGAAUAAACGCUCAACGUCUACCAUGAUCGAAUGCUAGCCUUCUAGCUUGCUUCGGCAGCACUAUAGGG"),
("aptamer_3", "GGGCGACCCUGAUGAGUCCCAAGUCGAAACGAUUCCUUUUUAAACUCAUGGUGCCCAGCCUCGCUCAGCA"),
]
print(f"{'Name':<15} {'Length':>8} {'MFE':>10} {'Structure'}")
print("-" * 80)
for name, seq in sequences:
struct, mfe = RNA.fold(seq)
print(f"{name:<15} {len(seq):>8} {mfe:>10.2f} {struct[:50]}...")
```
### Recipe: Check sgRNA Secondary Structure
When to use: Evaluate whether a CRISPR sgRNA guide sequence folds into secondary structures that reduce Cas9 binding efficiency.
```python
import RNA
def assess_sgrna(guide_seq: str, scaffold: str = None) -> dict:
"""
Assess sgRNA secondary structure.
guide_seq: 20-nt spacer sequence (RNA)
scaffold: constant sgRNA scaffold sequence (default: SpCas9)
"""
if scaffold is None:
# SpCas9 sgRNA scaffold (Addgene standard)
scaffold = "GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU"
full_sgrna = guide_seq.upper().replace("T", "U") + scaffold
fc = RNA.fold_compound(full_sgrna)
structure, mfe = fc.mfe()
fc.exp_params_rescale(mfe)
fc.pf()
bpp = fc.bpp()
n_guide = len(guide_seq)
# Sum each guide base's pairing probability against every partner in the full
# sgRNA — guide-to-scaffold pairs are what actually block Cas9 loading
guide_paired = sum(
bpp[min(i, j)][max(i, j)]
for i in range(1, n_guide + 1)
for j in range(1, len(full_sgrna) + 1)
if i != j
)
guide_accessibility = 1.0 - min(1.0, guide_paired / n_guide)
return {
"guide_seq": guide_seq,
"mfe": mfe,
"structure": structure[:n_guide],
"guide_access": guide_accessibility,
"predicted_ok": guide_accessibility > 0.7,
}
guides = ["GCACUAGUGACGCAUGGCAC", "GGGCAUAGCUAGCUAGCUAU", "AAAUUCGCACUAGUGACGCA"]
for g in guides:
result = assess_sgrna(g)
status = "OK" if result["predicted_ok"] else "WARN (self-paired)"
print(f"{g}: accessibility={result['guide_access']:.2f}, MFE={result['mfe']:.1f} kcal/mol [{status}]")
```
### Recipe: Mountain Plot Visualization of RNA Structure
When to use: Create a mountain plot — a classic RNA structure visualization showing stem height along the sequence.
```python
import RNA
import matplotlib.pyplot as plt
def dot_bracket_to_mountain(structure: str) -> list:
"""Convert dot-bracket structure to mountain plot heights."""
heights = []
level = 0
for c in structure:
if c == "(":
level += 1
heights.append(level)
if c == ")":
level -= 1
return heights
sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"
structure, mfe = RNA.fold(sequence)
heights = dot_bracket_to_mountain(structure)
fig, axes = plt.subplots(2, 1, figsize=(12, 5), sharex=True,
gridspec_kw={"height_ratios": [1, 3]})
# Top: sequence text
axes[0].text(0.5, 0.5, "tRNA-Phe | E. coli", ha="center", va="center",
fontsize=10, transform=axes[0].transAxes)
axes[0].axis("off")
# Bottom: mountain plot
axes[1].fill_between(range(len(sequence)), heights, step="mid",
color="#2c7bb6", alpha=0.7, label=f"MFE = {mfe:.2f} kcal/mol")
axes[1].set_xlabel("Nucleotide position")
axes[1].set_ylabel("Stem height")
axes[1].set_title("Mountain Plot")
axes[1].legend()
plt.tight_layout()
plt.savefig("mountain_plot.png", dpi=150, bbox_inches="tight")
print(f"Saved: mountain_plot.png (MFE structure: {structure[:40]}...)")
```
## Expected Outputs
| Output | Type | Description |
|--------|------|-------------|
| `structure` | string | Dot-bracket notation of MFE secondary structure; `(` and `)` for paired bases, `.` for unpaired |
| `mfe` | float (kcal/mol) | Minimum free energy of the predicted structure; more negative = more stable |
| `bpp` | (n+1)×(n+1) matrix | Base pair probability matrix from partition function; element `[i][j]` = P(i paired with j), 1-indexed |
| `bpp_matrix.png` | PNG | Heatmap visualization of base pair probabilities |
| `rna_accessibility.png` | PNG | Per-position probability of being unpaired |
| `mountain_plot.png` | PNG | Mountain plot of stem heights along the sequence |
## Troubleshooting
| Problem | Cause | Solution |
|---------|-------|----------|
| `ImportError: No module named 'RNA'` | ViennaRNA Python bindings not installed | Install via `conda install -c conda-forge -c bioconda viennarna` — the package lives in bioconda, not conda-forge; `pip install` alone may fail to link C library |
| `RuntimeError: RNAfold not found` | ViennaRNA CLI not in PATH | Confirm with `which RNAfold`; if using conda env, activate it before running scripts |
| MFE is unexpectedly positive (> 0) | Very short or repetitive sequence with no favorable pairs | Short sequences (< 10 nt) often have positive MFE; check sequence length and composition |
| `bpp` matrix all zeros after `fc.pf()` | `fc.pf()` was never called on that fold compound, or only the `i > j` half of the matrix is being read | Call `fc.pf()` before `fc.bpp()`, and read `bpp[i][j]` with `i < j` only — the lower triangle is empty |
| Suboptimal enumeration returns thousands of structures | Window too large for long sequences | Reduce delta to 2–3 kcal/mol for long sequences; very stable sequences have dense suboptimal ensembles |
| Co-fold (`RNA.cofold`) shows unexpected pairing | Intramolecular folding dominates in one strand | Inspect each strand separately first; low individual-strand MFE indicates strong self-structure interfering with duplex |
## References
- [ViennaRNA documentation](https://www.tbi.univie.ac.at/RNA/) — official documentation, parameter files, and Python API reference
- [Lorenz et al., Algorithms Mol Biol 2011](https://doi.org/10.1186/1748-7188-6-26) — ViennaRNA Package 2.0 paper (primary citation for structure prediction)
- [Turner & Mathews, Nucleic Acids Res 2010](https://doi.org/10.1093/nar/gkp892) — Nearest-neighbor thermodynamic parameters used by ViennaRNA
- [ViennaRNA GitHub: ViennaRNA/ViennaRNA](https://github.com/ViennaRNA/ViennaRNA) — source code, issue tracker, Python tutorial notebooks
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!