All-in-one FASTQ QC and adapter trimming. Auto-detects Illumina adapters, filters low-quality reads, corrects paired-end overlaps, emits HTML+JSON QC in one pass. 3-10x faster than Trim Galore/Trimmomatic. First step before STAR, BWA-MEM2, or Salmon.
Scanned 9/12/2026
Install to Claude Code
npx -y skills add stanfish06/skillquarium --skill fastp-fastq-preprocessing --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Fastp Fastq Preprocessing?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/stanfish06-fastp-fastq-preprocessing)More formats (shields.io, HTML) on the badges page.
---
name: "fastp-fastq-preprocessing"
description: "All-in-one FASTQ QC and adapter trimming. Auto-detects Illumina adapters, filters low-quality reads, corrects paired-end overlaps, emits HTML+JSON QC in one pass. 3-10x faster than Trim Galore/Trimmomatic. First step before STAR, BWA-MEM2, or Salmon."
license: "MIT"
---
# fastp — Fast FASTQ Quality Control and Adapter Trimming
## Overview
fastp performs adapter trimming, quality filtering, and QC reporting for Illumina FASTQ files in a single multi-threaded pass. It automatically detects adapter sequences from paired-end read overlaps — eliminating the need to specify adapters manually. fastp corrects mismatches in paired-end overlap regions, filters reads by quality score and length, removes polyX tails (polyA for RNA-seq), and generates interactive HTML and machine-readable JSON QC reports. Being 3–10× faster than Trim Galore and Trimmomatic while providing comparable or better results, fastp has become the standard preprocessing step before alignment in WGS, RNA-seq, and ChIP-seq pipelines.
## When to Use
- Trimming Illumina adapters and low-quality bases before alignment in any NGS pipeline (RNA-seq, WGS, WES, ChIP-seq, ATAC-seq)
- Generating per-sample QC reports (HTML + JSON) as the first step of a pipeline, before MultiQC aggregation
- Processing paired-end reads where adapter auto-detection from overlap is preferred over manual adapter specification
- Removing polyA tails from RNA-seq reads from 3′ end-enriched protocols (Smart-seq, QuantSeq)
- Splitting a FASTQ file by UMI or by index for demultiplexing workflows
- Use **Trim Galore** as an alternative when TrimGalore's detailed per-base quality report from FastQC is required alongside trimming
- Use **Trimmomatic** as an alternative for fine-grained control of sliding-window trimming steps
## Prerequisites
- **Software**: fastp (conda or pre-compiled binary)
- **Input**: raw Illumina FASTQ files (single-end or paired-end, .fastq or .fastq.gz)
> **Check before installing**: The tool may already be available in the current environment (e.g., inside a `pixi` / `conda` env). Run `command -v fastp` first and skip the install commands below if it returns a path. When running inside a pixi project, invoke the tool via `pixi run fastp` rather than bare `fastp`.
```bash
# Install with conda (recommended — always resolves to a current release)
conda install -c bioconda fastp
# Or download a pre-compiled binary (Linux) from the current release —
# asset naming changes between releases, so check
# https://github.com/OpenGene/fastp/releases/latest for the exact filename
# rather than hardcoding an old version's asset path.
# Verify
fastp --version
# current release as of this writing: fastp 1.3.6
```
## Quick Start
```bash
# Paired-end adapter trimming with QC report
fastp \
-i sample_R1.fastq.gz \
-I sample_R2.fastq.gz \
-o sample_R1.trimmed.fastq.gz \
-O sample_R2.trimmed.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8
echo "Trimmed reads in: sample_R1.trimmed.fastq.gz"
```
## Workflow
### Step 1: Single-End Adapter Trimming
Run fastp on single-end FASTQ with automatic adapter detection.
```bash
# Single-end with auto adapter detection
fastp \
-i sample.fastq.gz \
-o sample.trimmed.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8 \
--qualified_quality_phred 20 \
--length_required 36
echo "Input reads: $(zcat sample.fastq.gz | wc -l | awk '{print $1/4}')"
echo "Output reads: $(zcat sample.trimmed.fastq.gz | wc -l | awk '{print $1/4}')"
```
### Step 2: Paired-End Adapter Trimming
Process paired-end FASTQ files with overlap-based adapter detection and correction.
```bash
# Paired-end with overlap-based adapter auto-detection
fastp \
-i sample_R1.fastq.gz \
-I sample_R2.fastq.gz \
-o sample_R1.trimmed.fastq.gz \
-O sample_R2.trimmed.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8 \
--correction \
--detect_adapter_for_pe \
--qualified_quality_phred 20 \
--length_required 36
# Specify adapters explicitly (if auto-detection fails)
# fastp -i R1.fq.gz -I R2.fq.gz \
# --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
# --adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
# -o R1.out.fq.gz -O R2.out.fq.gz
```
### Step 3: Quality Filtering and Read Length Trimming
Configure quality and length thresholds for stricter or more lenient filtering.
```bash
# Strict quality filtering (e.g., for variant calling)
fastp \
-i sample_R1.fastq.gz \
-I sample_R2.fastq.gz \
-o sample_R1.filtered.fastq.gz \
-O sample_R2.filtered.fastq.gz \
-h sample_qc.html \
-j sample_qc.json \
--thread 8 \
--qualified_quality_phred 25 \
--unqualified_percent_limit 20 \
--length_required 50 \
--max_len1 150 \
--max_len2 150 \
--low_complexity_filter \
--complexity_threshold 30
echo "Filtering complete. Check sample_qc.html for pass/fail rates."
```
### Step 4: RNA-seq polyA Tail Removal
Remove polyA tails from 3′-enriched RNA-seq protocols before alignment.
```bash
# Remove polyA tails (QuantSeq 3′ mRNA-seq)
fastp \
-i quantseq_R1.fastq.gz \
-o quantseq_R1.trimmed.fastq.gz \
-h quantseq_qc.html \
-j quantseq_qc.json \
--thread 8 \
--trim_poly_x \
--poly_x_min_len 10 \
--qualified_quality_phred 20 \
--length_required 25
# For Smart-seq2 paired-end with polyA
fastp \
-i smartseq_R1.fastq.gz \
-I smartseq_R2.fastq.gz \
-o smartseq_R1.trimmed.fastq.gz \
-O smartseq_R2.trimmed.fastq.gz \
--trim_poly_x --poly_x_min_len 10 \
--thread 8 \
-h smartseq_qc.html -j smartseq_qc.json
```
### Step 5: Parse QC Report JSON for Pipeline Monitoring
Extract key QC metrics from fastp's JSON output for automated quality gates.
```python
import json
from pathlib import Path
def parse_fastp_json(json_path: str) -> dict:
with open(json_path) as f:
data = json.load(f)
before = data["summary"]["before_filtering"]
after = data["summary"]["after_filtering"]
return {
"total_reads_in": before["total_reads"],
"total_reads_out": after["total_reads"],
"pct_passed": after["total_reads"] / before["total_reads"] * 100,
"q30_rate_before": before["q30_rate"] * 100,
"q30_rate_after": after["q30_rate"] * 100,
"mean_len_before": before["read1_mean_length"],
"mean_len_after": after["read1_mean_length"],
"adapter_trimmed": data["filtering_result"]["adapter_trimmed"],
}
metrics = parse_fastp_json("sample_qc.json")
for key, val in metrics.items():
print(f"{key:25s}: {val:.1f}" if isinstance(val, float) else f"{key:25s}: {val:,}")
# Quality gate: fail if < 70% reads pass filter
if metrics["pct_passed"] < 70:
print("WARNING: Low pass rate — check raw data quality")
```
### Step 6: Batch Preprocessing Pipeline
Process multiple samples sequentially with per-sample QC summaries.
```bash
#!/bin/bash
# Batch paired-end preprocessing for multiple samples
SAMPLES=(ctrl_1 ctrl_2 treat_1 treat_2)
DATA="data"
OUT="trimmed"
QC="qc/fastp"
THREADS=8
mkdir -p "$OUT" "$QC"
for sample in "${SAMPLES[@]}"; do
echo "=== Processing $sample ==="
fastp \
-i "$DATA/${sample}_R1.fastq.gz" \
-I "$DATA/${sample}_R2.fastq.gz" \
-o "$OUT/${sample}_R1.fastq.gz" \
-O "$OUT/${sample}_R2.fastq.gz" \
-h "$QC/${sample}.html" \
-j "$QC/${sample}.json" \
--thread $THREADS \
--correction \
--detect_adapter_for_pe \
--qualified_quality_phred 20 \
--length_required 36 \
2>&1 | grep -E "Read[12]|Filtering|Adapter|passed"
done
# Aggregate QC metrics
python3 - << 'EOF'
import json, pandas as pd
from pathlib import Path
rows = []
for jf in sorted(Path("qc/fastp").glob("*.json")):
with open(jf) as f: data = json.load(f)
after = data["summary"]["after_filtering"]
before = data["summary"]["before_filtering"]
rows.append({
"sample": jf.stem,
"reads_in": before["total_reads"],
"reads_out": after["total_reads"],
"pct_passed": round(after["total_reads"]/before["total_reads"]*100, 1),
"q30_after": round(after["q30_rate"]*100, 1),
})
df = pd.DataFrame(rows)
print(df.to_string(index=False))
df.to_csv("fastp_summary.tsv", sep="\t", index=False)
EOF
# Run MultiQC to aggregate all fastp JSON reports
multiqc qc/fastp/ -o qc/ -n fastp_multiqc_report
```
## Key Parameters
| Parameter | Default | Range/Options | Effect |
|-----------|---------|---------------|--------|
| `-i / -I` | required | file path | Input FASTQ (R1 and R2 for paired-end) |
| `-o / -O` | required | file path | Output trimmed FASTQ (R1 and R2) |
| `-h / -j` | — | file path | HTML and JSON QC report output paths |
| `--thread` | `3` | 1–16 | CPU threads; 8 is a good balance |
| `--qualified_quality_phred` | `15` | 0–40 | Minimum base quality (Phred); 20 = 1% error |
| `--length_required` | `15` | 1–1000 | Minimum read length after trimming; discard shorter reads |
| `--correction` | off | flag | Correct mismatches in PE overlap region |
| `--detect_adapter_for_pe` | off | flag | Enable overlap-based adapter auto-detection for PE data |
| `--adapter_sequence` | auto | string | Explicit R1 adapter; overrides auto-detection |
| `--trim_poly_x` | off | flag | Trim polyX (polyA/polyT) tails; use for 3′-enriched RNA-seq |
| `--low_complexity_filter` | off | flag | Filter reads with low complexity (< 30% complexity by default) |
| `--split` | off | integer | Split output into N files per direction (for parallelism) |
## Common Recipes
### Recipe 1: Integrate fastp into a Snakemake Pipeline
```python
# Snakefile — fastp trimming rule
configfile: "config.yaml"
SAMPLES = config["samples"]
rule fastp_pe:
input:
r1 = "data/{sample}_R1.fastq.gz",
r2 = "data/{sample}_R2.fastq.gz"
output:
r1 = "trimmed/{sample}_R1.fastq.gz",
r2 = "trimmed/{sample}_R2.fastq.gz",
html = "qc/{sample}_fastp.html",
json = "qc/{sample}_fastp.json"
threads: 8
shell:
"""
fastp -i {input.r1} -I {input.r2} \
-o {output.r1} -O {output.r2} \
-h {output.html} -j {output.json} \
--thread {threads} \
--correction --detect_adapter_for_pe \
--qualified_quality_phred 20 \
--length_required 36
"""
```
### Recipe 2: Aggregate fastp JSON Reports with Python
```python
import json
import pandas as pd
from pathlib import Path
qc_dir = Path("qc/fastp")
records = []
for jf in sorted(qc_dir.glob("*.json")):
with open(jf) as f:
d = json.load(f)
b = d["summary"]["before_filtering"]
a = d["summary"]["after_filtering"]
records.append({
"sample": jf.stem.replace("_fastp", ""),
"reads_in_M": b["total_reads"] / 1e6,
"reads_out_M": a["total_reads"] / 1e6,
"pct_passed": a["total_reads"] / b["total_reads"] * 100,
"q30_pct": a["q30_rate"] * 100,
"mean_len_bp": a["read1_mean_length"],
"adapter_pct": d["filtering_result"]["adapter_trimmed"] / b["total_reads"] * 100,
})
df = pd.DataFrame(records).round(2)
print(df.to_string(index=False))
# Flag low-quality samples
low_q = df[df["pct_passed"] < 80]
if not low_q.empty:
print(f"\nSamples with < 80% reads passing: {list(low_q['sample'])}")
```
## Expected Outputs
| Output | Format | Description |
|--------|--------|-------------|
| `*_R1.trimmed.fastq.gz` | FASTQ.gz | Trimmed R1 reads (adapters and low-quality bases removed) |
| `*_R2.trimmed.fastq.gz` | FASTQ.gz | Trimmed R2 reads (paired-end only) |
| `*.html` | HTML | Interactive QC report with per-base quality, GC content, adapter plots |
| `*.json` | JSON | Machine-readable QC metrics for automation and MultiQC parsing |
| `fastp.log` | Text | stderr summary with pass/fail read counts and filtering statistics |
## Troubleshooting
| Problem | Cause | Solution |
|---------|-------|----------|
| Adapter not detected in SE mode | SE reads require explicit adapter or `--adapter_sequence` | Use `--detect_adapter_for_pe` only for PE; specify adapter for SE: `--adapter_sequence AGATCGGAAGAGC` |
| Very high adapter content (> 50%) | Short inserts (small RNA, miRNA) or poor library prep | Check library protocol; use `--overlap_len_require 10` to adjust overlap sensitivity |
| Too many reads filtered (< 60% pass) | Over-strict quality thresholds or low-quality sequencing run | Relax `--qualified_quality_phred` to 15; lower `--length_required` to 25 |
| JSON output missing fields | Old fastp version | Upgrade: `conda update fastp` or download latest binary from GitHub |
| MultiQC not parsing fastp JSON | JSON file not in the scanned directory | Run `multiqc qc/` not `multiqc .`; verify JSON files exist with `ls qc/*.json` |
| Output FASTQ is empty | All reads filtered (wrong input or extreme thresholds) | Verify input FASTQ with `zcat sample.fq.gz \| head -8`; run without `--low_complexity_filter` first |
| Slow performance on large files | Low thread count | Increase `--thread` to 8–12; ensure input is on fast storage (SSD) |
| polyA not removed | `--trim_poly_x` not set | Add `--trim_poly_x --poly_x_min_len 10` for 3′-enriched protocols |
## References
- [fastp GitHub: OpenGene/fastp](https://github.com/OpenGene/fastp) — source code, changelog, and usage guide
- Chen S et al. (2018) "fastp: an ultra-fast all-in-one FASTQ preprocessor" — *Bioinformatics* 34(17):i884-i890. [DOI:10.1093/bioinformatics/bty560](https://doi.org/10.1093/bioinformatics/bty560)
- [fastp documentation](https://github.com/OpenGene/fastp#readme) — full parameter reference and recipes
- [MultiQC fastp module](https://multiqc.info/modules/fastp/) — aggregating fastp JSON reports across samples
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!