Skills DirectorySkills Directory
SkillsLearnSecurityCategoriesDocsCommunityBlog
Sign InSubmit Skill
Skills Directory

Security-tested agent skills for Claude, coding agents, and AI workflows.

Directory

  • Browse Skills
  • All Skills A–Z
  • Claude Skills
  • Claude Code Skills
  • Agent Skills
  • Categories
  • Submit a Skill

Learn

  • Learn Hub
  • Install Claude Skills
  • Write SKILL.md
  • Skills vs MCP
  • Directories Compared

Security

  • Security
  • Methodology
  • Secure Claude Skills
  • Security Badges

Company

  • About
  • Community
  • Blog
  • API Docs
  • Advertise

2026 Skills Directory. All rights reserved.

Back to skills

Adapter Trimming

ASecurity

Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.

2 stars
0 votes
0 copies
0 views
Added 9/22/2026
toolsbashapiperformance

Works with

cliapi

Security Analysis

A100/100

Scanned 9/22/2026

Install to Claude Code

$npx -y skills add peacezha/HPClaw --skill adapter-trimming --agent claude-code

Installs into .claude/skills of the current project.

Are you the author of Adapter Trimming?

Add the live security badge to your README — it updates automatically with every re-scan.

Security grade badge for Adapter Trimming
[![Security: A — Skills Directory](https://www.skillsdirectory.com/api/skills/peacezha-adapter-trimming/badge)](https://www.skillsdirectory.com/skills/peacezha-adapter-trimming)

More formats (shields.io, HTML) on the badges page.

Download Zip
Files
SKILL.md
---
name: bio-read-qc-adapter-trimming
description: Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
tool_type: cli
primary_tool: cutadapt
---

## Version Compatibility

Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+

Before using code patterns, verify installed versions match. If versions differ:
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Adapter Trimming

Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).

**"Trim adapters from reads"** -> Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment.
- CLI: `cutadapt -a ADAPTER -o out.fq in.fq` or `trimmomatic PE` with ILLUMINACLIP
- CLI: `fastp -i in.fq -o out.fq` (auto-detects adapters)

## Common Adapter Sequences

| Platform/Kit | Adapter | Sequence |
|--------------|---------|----------|
| Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| Nextera | Transposase | CTGTCTCTTATACACATCT |
| Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG |
| Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |

## Cutadapt

### Single-End Reads

```bash
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz

# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz

# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz

# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
```

### Paired-End Reads

```bash
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
         -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         sample_R1.fastq.gz sample_R2.fastq.gz

# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         sample_R1.fastq.gz sample_R2.fastq.gz
```

### Adapter Options

```bash
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq

# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq

# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq

# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq

# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
```

### Linked Adapters

```bash
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq

# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
```

### Filtering After Trimming

```bash
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq

# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq

# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq

# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq

# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
```

### Paired-End Filtering

```bash
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
         -o R1.fq -p R2.fq in_R1.fq in_R2.fq

# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
         --too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
         -o R1.fq -p R2.fq in_R1.fq in_R2.fq
```

### Action Options

```bash
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq

# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq

# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
```

## Trimmomatic

### Single-End Mode

```bash
trimmomatic SE -phred33 \
    input.fastq.gz output.fastq.gz \
    ILLUMINACLIP:adapters.fa:2:30:10
```

### Paired-End Mode

```bash
trimmomatic PE -phred33 -threads 4 \
    input_R1.fastq.gz input_R2.fastq.gz \
    output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
    output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
    ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
```

### ILLUMINACLIP Parameters

```bash
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>

# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)

# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
```

### Built-in Adapter Files

Trimmomatic includes adapter files:
- `TruSeq2-SE.fa` - TruSeq v2 single-end
- `TruSeq2-PE.fa` - TruSeq v2 paired-end
- `TruSeq3-SE.fa` - TruSeq v3 single-end
- `TruSeq3-PE.fa` - TruSeq v3 paired-end
- `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode)
- `NexteraPE-PE.fa` - Nextera paired-end

### Find Trimmomatic Adapters

```bash
# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/

# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
```

## Performance

```bash
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq

# Trimmomatic threads
trimmomatic PE -threads 8 ...
```

## Verify Trimming

```bash
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz

# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
```

## Related Skills

- quality-reports - Check adapter content with FastQC
- quality-filtering - Quality trimming after adapter removal
- fastp-workflow - Combined adapter and quality trimming

Attribution

peacezhapeacezha
View sourceMore from peacezha →
SSkills DirectorySkills Directory

Ship a skill? Prove it's safe.

Free 120-pattern security scan, letter grade, and an embeddable README badge.

Submit a skill

Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.

Comments (0)

No comments yet. Be the first to comment!

SSkills DirectorySkills Directory

Ship a skill? Prove it's safe.

Free 120-pattern security scan, letter grade, and an embeddable README badge.

Submit a skill

Related Skills

ucoz-landing-skill

Playbook for creating and editing uCoz landing pages via MCP tools (`templates_tool`, `ftp_tool`, `modules_tool`). Use for tasks such as: "build a landing page", "update the homepage as a landing page", "create a promo page on the homepage", "add a lead form / menu / SEO to the homepage". Homepage: `page_list`, `page_get`; first publish — `page_update` with full `page_tmpl`; HTML edits after generation — `patch_template` (module_id=2, template_id=1), not `update_template`. Activate the mail f...

107 votes

Paperclip

Interact with the Paperclip control plane API for task coordination and governance. Use when checking assignments, updating issue status, posting comments, delegating work, managing routines, or calling Paperclip API endpoints.

805541 votes

Daw Music

Digital Audio Workstation usage, music composition, interactive music systems, and game audio implementation for immersive soundscapes.

761 votes

Instantly Rdsthomas Mission Control

Instantly.ai cold email outreach API - manage campaigns, leads, accounts, and analytics. Use for cold email automation, lead management, campaign creation/monitoring, and email account warmup.

761 votes

Caveman Compress

Compress natural language memory files (CLAUDE.md, todos, preferences) into caveman format to save input tokens. Preserves all technical substance, code, URLs, and structure. Compressed version overwrites the original file. Human-readable backup saved as FILE.original.md. Trigger: /caveman-compress FILEPATH or "compress memory file"

1066600 votes
View all in tools →