--> --- name: bio-transcription-translation description: Transcribe DNA to RNA and translate to protein using Biopython. Use when converting between DNA, RNA, and protein sequences, finding ORFs, or using alternative codon tables. tool_type: python primary_tool: Bio.Seq measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command --- Convert between DNA, RNA, and protein sequences using Biopython.
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill transcription-translation --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Transcription Translation?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-transcription-translation-ai-agentic-skills-by-dr-mia)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-transcription-translation
description: Transcribe DNA to RNA and translate to protein using Biopython. Use when converting between DNA, RNA, and protein sequences, finding ORFs, or using alternative codon tables.
tool_type: python
primary_tool: Bio.Seq
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Transcription and Translation
Convert between DNA, RNA, and protein sequences using Biopython.
## Required Import
```python
from Bio.Seq import Seq
```
## Core Methods
### Transcription (DNA to RNA)
```python
dna = Seq('ATGCGATCGATCG')
rna = dna.transcribe() # Returns Seq('AUGCGAUCGAUCG')
```
Transcription replaces T with U. Works on coding strand (5' to 3').
### Back Transcription (RNA to DNA)
```python
rna = Seq('AUGCGAUCGAUCG')
dna = rna.back_transcribe() # Returns Seq('ATGCGATCGATCG')
```
### Translation (RNA/DNA to Protein)
```python
# From coding DNA (includes ATG start)
coding_dna = Seq('ATGTTTGGT')
protein = coding_dna.translate() # Returns Seq('MFG')
# From RNA
rna = Seq('AUGUUUGGU')
protein = rna.translate() # Returns Seq('MFG')
```
## Translation Options
### Stop at First Stop Codon
```python
seq = Seq('ATGTTTGGTTAAGGG')
protein = seq.translate(to_stop=True) # Stops at TAA, excludes stop
```
### Include Stop Codon Symbol
```python
seq = Seq('ATGTTTGGTTAA')
protein = seq.translate() # Returns Seq('MFG*')
```
### Alternative Codon Tables
Biopython supports NCBI codon tables. Common tables:
| ID | Name | Use Case |
|----|------|----------|
| 1 | Standard | Default, most organisms |
| 2 | Vertebrate Mitochondrial | Human/vertebrate mitochondria |
| 4 | Mold Mitochondrial | Fungi, protozoa mitochondria |
| 5 | Invertebrate Mitochondrial | Insects, worms mitochondria |
| 6 | Ciliate Nuclear | Tetrahymena, Paramecium |
| 11 | Bacterial/Archaeal | Prokaryotes, plastids |
```python
# Bacterial translation
seq = Seq('ATGTTTGGT')
protein = seq.translate(table=11)
# Mitochondrial translation
protein = seq.translate(table=2)
# By name
protein = seq.translate(table='Vertebrate Mitochondrial')
```
### CDS Translation (Complete Coding Sequence)
For validated coding sequences with proper start/stop:
```python
cds = Seq('ATGTTTGGTTAA') # Must start with start codon, end with stop
protein = cds.translate(cds=True) # Validates and removes stop
```
The `cds=True` option:
- Validates start codon (ATG or alternative)
- Validates stop codon at end
- Removes stop codon from result
- Raises error if invalid CDS
## Code Patterns
### Basic Transcription and Translation Pipeline
```python
dna = Seq('ATGTTTGGTCATTAA')
rna = dna.transcribe()
protein = rna.translate()
print(f'DNA: {dna}')
print(f'RNA: {rna}')
print(f'Protein: {protein}')
```
### Translate All Six Reading Frames
```python
def six_frame_translation(seq):
frames = []
for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
for frame in range(3):
length = 3 * ((len(s) - frame) // 3)
fragment = s[frame:frame + length]
frames.append((strand, frame, fragment.translate()))
return frames
seq = Seq('ATGCGATCGATCGATCGATCG')
for strand, frame, protein in six_frame_translation(seq):
print(f'{strand}{frame}: {protein}')
```
### Find All ORFs (Start to Stop)
```python
def find_orfs(seq, min_length=30):
orfs = []
for strand, s in [('+', seq), ('-', seq.reverse_complement())]:
for frame in range(3):
trans = s[frame:].translate()
aa_start = 0
while True:
start = trans.find('M', aa_start)
if start == -1:
break
stop = trans.find('*', start)
if stop == -1:
stop = len(trans)
orf = trans[start:stop]
if len(orf) * 3 >= min_length:
orfs.append((strand, frame, start * 3 + frame, str(orf)))
aa_start = start + 1
return orfs
seq = Seq('ATGCGATCGATCGATCGATCGTAA')
for strand, frame, pos, orf in find_orfs(seq, min_length=3):
print(f'{strand} frame {frame} pos {pos}: {orf}')
```
### Translate with Quality Check
```python
def translate_cds_safe(seq):
try:
return seq.translate(cds=True)
except Exception as e:
return seq.translate(to_stop=True) # Fallback
```
### Get Codon Table Info
```python
from Bio.Data import CodonTable
table = CodonTable.unambiguous_dna_by_id[1]
print(f'Start codons: {table.start_codons}')
print(f'Stop codons: {table.stop_codons}')
```
## Common Errors
| Error | Cause | Solution |
|-------|-------|----------|
| `TranslationError: First codon is not a start codon` | Used `cds=True` without valid start | Remove `cds=True` or fix sequence |
| `TranslationError: Final codon is not a stop codon` | Used `cds=True` without stop codon | Remove `cds=True` or add stop codon |
| `TranslationError: Sequence length not multiple of 3` | Partial codons at end | Trim sequence to multiple of 3 |
| Unexpected amino acids | Wrong codon table | Specify correct table for organism |
## Decision Tree
```
Need to convert sequence?
├── DNA to RNA?
│ └── Use seq.transcribe()
├── RNA to DNA?
│ └── Use seq.back_transcribe()
├── DNA/RNA to protein?
│ ├── Complete CDS with start/stop?
│ │ └── Use translate(cds=True)
│ ├── Stop at first stop codon?
│ │ └── Use translate(to_stop=True)
│ ├── Non-standard organism?
│ │ └── Use translate(table=N)
│ └── Get all including stop symbol?
│ └── Use translate()
└── Find all ORFs?
└── Translate all six frames, search for M...*
```
## Related Skills
- seq-objects - Create Seq objects for translation
- reverse-complement - Translate both strands (six-frame translation)
- codon-usage - Analyze codon bias in coding sequences
- sequence-io/read-sequences - Parse GenBank files with CDS features
- database-access/entrez-fetch - Fetch CDS sequences from NCBI for translation
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!