--> --- name: bio-small-rna-seq-smrna-preprocessing description: Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis. tool_type: cli primary_tool: cutadapt measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command ---
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill smrna-preprocessing --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Smrna Preprocessing?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-smrna-preprocessing-ai-agentic-skills-by-dr-mia)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-small-rna-seq-smrna-preprocessing
description: Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
tool_type: cli
primary_tool: cutadapt
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Small RNA Preprocessing
## Adapter Trimming with Cutadapt
Small RNA libraries have specific 3' adapters that must be removed:
```bash
# Standard Illumina TruSeq small RNA adapter
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-M 30 \
--discard-untrimmed \
-o trimmed.fastq.gz \
input.fastq.gz
# -a: 3' adapter sequence
# -m 18: Minimum length (miRNAs are 18-25 nt)
# -M 30: Maximum length (exclude longer fragments)
# --discard-untrimmed: Remove reads without adapter (likely not small RNA)
```
## Common Small RNA Adapters
| Kit | 3' Adapter Sequence |
|-----|---------------------|
| Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG |
| NEBNext | AGATCGGAAGAGCACACGTCT |
| QIAseq | AACTGTAGGCACCATCAAT |
| Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |
## Size Selection
```bash
# Filter by length after trimming
cutadapt \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 -M 26 \
-o mirna_length.fastq.gz \
input.fastq.gz
# miRNA: 18-26 nt (typically 21-23 nt)
# piRNA: 26-32 nt
# snoRNA: variable, typically longer
```
## Quality Trimming
```bash
# Trim low-quality bases from 3' end before adapter removal
cutadapt \
-q 20 \
-a TGGAATTCTCGGGTGCCAAGG \
-m 18 \
-o trimmed.fastq.gz \
input.fastq.gz
```
## Using fastp for Small RNA
```bash
# fastp with small RNA settings
fastp \
--in1 input.fastq.gz \
--out1 trimmed.fastq.gz \
--adapter_sequence TGGAATTCTCGGGTGCCAAGG \
--length_required 18 \
--length_limit 30 \
--html report.html
# Note: fastp auto-detects adapters but specifying is more reliable
```
## Collapse Identical Reads
For small RNAs, collapsing identical sequences reduces computation:
```bash
# Using seqkit
seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta
# Using fastx_toolkit (legacy)
fastx_collapser -i trimmed.fastq -o collapsed.fasta
```
## Python Preprocessing
```python
import gzip
from collections import Counter
def collapse_reads(fastq_path):
'''Collapse identical sequences and count occurrences'''
counts = Counter()
with gzip.open(fastq_path, 'rt') as f:
while True:
header = f.readline()
if not header:
break
seq = f.readline().strip()
f.readline() # +
f.readline() # qual
# Only keep reads in miRNA size range
if 18 <= len(seq) <= 26:
counts[seq] += 1
return counts
# Write collapsed FASTA
def write_collapsed_fasta(counts, output_path):
with open(output_path, 'w') as f:
for i, (seq, count) in enumerate(counts.most_common()):
f.write(f'>seq_{i}_x{count}\n{seq}\n')
```
## QC Metrics for Small RNA
Key metrics to check:
- Read length distribution (should peak at 21-23 nt for miRNA)
- Adapter content (high if library is good)
- Percentage of reads in target size range
```python
import matplotlib.pyplot as plt
from collections import Counter
def plot_length_distribution(fastq_path):
lengths = Counter()
with gzip.open(fastq_path, 'rt') as f:
for i, line in enumerate(f):
if i % 4 == 1: # Sequence line
lengths[len(line.strip())] += 1
plt.bar(lengths.keys(), lengths.values())
plt.xlabel('Read Length')
plt.ylabel('Count')
plt.title('Small RNA Length Distribution')
plt.savefig('length_dist.png')
```
## Related Skills
- mirdeep2-analysis - Novel miRNA discovery
- mirge3-analysis - Fast miRNA quantification
- read-qc/adapter-trimming - General adapter trimming
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!