--> --- name: bio-crispr-screens-library-design description: CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens. tool_type: python primary_tool: crispor measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command ---
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill library-design --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Library Design?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-library-design-ai-agentic-skills-by-dr-mia)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-crispr-screens-library-design
description: CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.
tool_type: python
primary_tool: crispor
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Library Design
## sgRNA Selection Criteria
```python
import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq
def score_sgrna(sequence, pam='NGG'):
'''Score sgRNA based on multiple criteria.'''
scores = {}
gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2
if len(sequence) >= 4:
has_poly_t = 'TTTT' in sequence
scores['poly_t'] = 0 if has_poly_t else 1
starts_with_g = sequence.startswith('G')
scores['start_g'] = 1 if starts_with_g else 0.5
scores['length'] = 1 if len(sequence) == 20 else 0.8
overall = np.mean(list(scores.values()))
return overall, scores
def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
'''Design sgRNAs targeting a gene.'''
candidates = []
pam_pattern = pam.replace('N', '[ACGT]')
import re
for strand in ['+', '-']:
seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())
for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
sgrna = match.group(1)
position = match.start()
if strand == '-':
position = len(seq) - position - 23
score, details = score_sgrna(sgrna)
candidates.append({
'sequence': sgrna,
'pam': match.group(2),
'strand': strand,
'position': position,
'score': score,
'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
**details
})
candidates_df = pd.DataFrame(candidates)
candidates_df = candidates_df.sort_values('score', ascending=False)
return candidates_df.head(n_guides)
gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])
```
## Library Composition
```python
def design_library(gene_list, guides_per_gene=4, include_controls=True):
'''Design complete library for gene list.'''
library = []
for gene in gene_list:
gene_data = get_gene_sequence(gene)
guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)
for idx, guide in guides.iterrows():
library.append({
'gene': gene,
'gene_id': gene_data.get('ensembl_id', ''),
'guide_number': idx + 1,
'sequence': guide['sequence'],
'pam': guide['pam'],
'position': guide['position'],
'strand': guide['strand'],
'score': guide['score'],
'type': 'targeting'
})
if include_controls:
controls = design_control_guides()
library.extend(controls)
return pd.DataFrame(library)
def get_gene_sequence(gene_name):
'''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
return {
'sequence': 'ATGC' * 250,
'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
}
genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')
```
## Control Guide Design
```python
def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
'''Design control guides for library.'''
controls = []
for i in range(n_nontargeting):
sequence = generate_nontargeting_sequence()
controls.append({
'gene': f'NonTargeting_{i+1}',
'gene_id': '',
'guide_number': 1,
'sequence': sequence,
'pam': 'NGG',
'position': -1,
'strand': '',
'score': 0,
'type': 'non-targeting'
})
essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
for gene in essential_genes[:n_essential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'essential-control'
})
nonessential_genes = ['AAVS1', 'ROSA26']
for gene in nonessential_genes[:n_nonessential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'safe-harbor-control'
})
return controls
def generate_nontargeting_sequence(length=20):
'''Generate random non-targeting sequence.'''
while True:
seq = ''.join(np.random.choice(['A', 'C', 'G', 'T'], length))
gc = (seq.count('G') + seq.count('C')) / length
if 0.4 <= gc <= 0.6 and 'TTTT' not in seq:
return seq
def get_validated_guide(gene):
'''Get validated guide sequence for control gene.'''
validated = {
'RPS3': 'GAGCTTCTTCAGCAGCATGG',
'RPL11': 'GAAACAGGGCATCATCTACG',
'EIF3A': 'GTGCAAGAGGATGATGACAA',
'AAVS1': 'GGGGCCACTAGGGACAGGAT',
'ROSA26': 'GAAGATGGGCGGGAGTCTTC'
}
return validated.get(gene, generate_nontargeting_sequence())
```
## Off-Target Analysis
```python
def check_offtargets(guide_sequence, genome_index, max_mismatches=3):
'''Check for potential off-target sites.'''
from subprocess import run
import tempfile
with tempfile.NamedTemporaryFile(mode='w', suffix='.fa', delete=False) as f:
f.write(f'>guide\n{guide_sequence}\n')
query_file = f.name
result = run(
['bowtie', '-a', '-n', str(max_mismatches), '-l', '20', genome_index, '-f', query_file],
capture_output=True, text=True
)
offtargets = []
for line in result.stdout.strip().split('\n'):
if line:
fields = line.split('\t')
offtargets.append({
'chromosome': fields[2],
'position': int(fields[3]),
'strand': fields[1],
'mismatches': int(fields[7]) if len(fields) > 7 else 0
})
return offtargets
def filter_by_offtargets(library_df, genome_index, max_offtargets=10):
'''Filter library to remove guides with too many off-targets.'''
filtered = []
for _, guide in library_df.iterrows():
offtargets = check_offtargets(guide['sequence'], genome_index)
n_offtargets = len([ot for ot in offtargets if ot['mismatches'] <= 2])
if n_offtargets <= max_offtargets:
guide_dict = guide.to_dict()
guide_dict['n_offtargets'] = n_offtargets
filtered.append(guide_dict)
return pd.DataFrame(filtered)
```
## Oligo Design for Cloning
```python
def design_oligos(library_df, vector='lentiGuide-Puro'):
'''Design oligos for library cloning.'''
vector_specs = {
'lentiGuide-Puro': {
'forward_prefix': 'CACCG',
'forward_suffix': '',
'reverse_prefix': 'AAAC',
'reverse_suffix': 'C'
},
'pLKO': {
'forward_prefix': 'CCGG',
'forward_suffix': 'CTCGAG',
'reverse_prefix': 'AATTCTCGAG',
'reverse_suffix': ''
}
}
spec = vector_specs.get(vector, vector_specs['lentiGuide-Puro'])
oligos = []
for _, guide in library_df.iterrows():
seq = guide['sequence']
forward = spec['forward_prefix'] + seq + spec['forward_suffix']
reverse = spec['reverse_prefix'] + str(Seq(seq).reverse_complement()) + spec['reverse_suffix']
oligos.append({
'guide_id': f"{guide['gene']}_{guide['guide_number']}",
'gene': guide['gene'],
'guide_sequence': seq,
'forward_oligo': forward,
'reverse_oligo': reverse,
'type': guide.get('type', 'targeting')
})
return pd.DataFrame(oligos)
oligos = design_oligos(library)
oligos.to_csv('library_oligos.csv', index=False)
print(f'Designed {len(oligos)} oligo pairs')
```
## Pool Design for Synthesis
```python
def design_array_oligos(library_df, array_format='12K'):
'''Design array oligos for pooled synthesis.'''
formats = {
'12K': {'capacity': 12000, 'length': 200},
'92K': {'capacity': 92000, 'length': 150},
'244K': {'capacity': 244000, 'length': 60}
}
spec = formats[array_format]
primer_5 = 'AGGCTTGGATTTCTATAACTTCGTATAGCATACATTATACGAAGTTAT'
primer_3 = 'ATAACTTCGTATAATGTATGCTATACGAAGTTATCTTGGATTTCTAGA'
scaffold = 'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC'
array_oligos = []
for _, guide in library_df.iterrows():
full_oligo = primer_5 + guide['sequence'] + scaffold + primer_3
if len(full_oligo) > spec['length']:
print(f"Warning: {guide['gene']} oligo too long for {array_format}")
continue
array_oligos.append({
'id': f"{guide['gene']}_{guide['guide_number']}",
'sequence': full_oligo,
'length': len(full_oligo)
})
if len(array_oligos) > spec['capacity']:
print(f"Warning: Library ({len(array_oligos)}) exceeds {array_format} capacity ({spec['capacity']})")
return pd.DataFrame(array_oligos)
array_oligos = design_array_oligos(library, '92K')
array_oligos.to_csv('array_synthesis.csv', index=False)
```
## Library QC
```python
def qc_library(library_df):
'''Quality control checks for library design.'''
qc = {}
qc['total_guides'] = len(library_df)
qc['unique_genes'] = library_df[library_df['type'] == 'targeting']['gene'].nunique()
qc['guides_per_gene'] = library_df[library_df['type'] == 'targeting'].groupby('gene').size().describe()
gc_contents = library_df['sequence'].apply(lambda x: (x.count('G') + x.count('C')) / len(x))
qc['gc_mean'] = gc_contents.mean()
qc['gc_std'] = gc_contents.std()
qc['gc_range'] = (gc_contents.min(), gc_contents.max())
has_poly_t = library_df['sequence'].apply(lambda x: 'TTTT' in x)
qc['poly_t_count'] = has_poly_t.sum()
type_counts = library_df['type'].value_counts()
qc['control_ratio'] = type_counts.get('non-targeting', 0) / len(library_df)
return qc
qc = qc_library(library)
print('Library QC:')
for key, value in qc.items():
print(f' {key}: {value}')
```
## Alternative PAM Systems
The examples above use SpCas9 with NGG PAM. Alternative systems expand targeting range:
| System | PAM | Use Case |
|--------|-----|----------|
| SpCas9 | NGG | Standard, most validated |
| SpCas9-NG | NG | Relaxed PAM requirement |
| SpRY | NRN/NYN | Near-PAMless, broadest targeting |
| Cas12a (Cpf1) | TTTV | AT-rich regions, staggered cuts |
| SaCas9 | NNGRRT | AAV delivery (smaller gene) |
For alternative PAMs, modify the `design_sgrnas_for_gene()` function:
```python
# Cas12a example (TTTV PAM, 23nt guide)
def design_cas12a_guides(gene_sequence, n_guides=4):
pam_pattern = 'TTT[ACG]' # TTTV
guide_length = 23
for match in re.finditer(f'({pam_pattern})([ACGT]{{{guide_length}}})', gene_sequence):
pam = match.group(1)
guide = match.group(2)
# Cas12a cuts downstream of guide
# ...
```
## Related Skills
- mageck-analysis - Analyze screen results
- crispresso-editing - Validate editing efficiency
- screen-qc - QC sequencing data
- hit-calling - Identify screen hits
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!