--> --- name: bio-workflows-crispr-editing-pipeline description: End-to-end CRISPR experiment design from target selection to delivery-ready constructs. Covers guide RNA design, off-target assessment, and specialized editing strategies including knockouts, base editing, and HDR knockins. Use when designing complete CRISPR editing experiments for gene knockout, correction, or tagging. tool_type: mixed primary_tool: crisprscan workflow: true depends_on: - genome-engineering/grna-design - genome...
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill crispr-editing-pipeline --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Crispr Editing Pipeline?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-crispr-editing-pipeline-ai-agentic-skills-by-dr-mia)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-workflows-crispr-editing-pipeline
description: End-to-end CRISPR experiment design from target selection to delivery-ready constructs. Covers guide RNA design, off-target assessment, and specialized editing strategies including knockouts, base editing, and HDR knockins. Use when designing complete CRISPR editing experiments for gene knockout, correction, or tagging.
tool_type: mixed
primary_tool: crisprscan
workflow: true
depends_on:
- genome-engineering/grna-design
- genome-engineering/off-target-prediction
- genome-engineering/base-editing-design
- genome-engineering/prime-editing-design
- genome-engineering/hdr-template-design
qc_checkpoints:
- after_grna_design: "Activity score >0.6, no poly-T runs, GC 40-70%"
- after_offtarget: "Specificity score >0.7, no coding off-targets with <3 mismatches"
- after_template: "Homology arms verified, PAM disrupted in donor"
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# CRISPR Editing Pipeline
Complete workflow for CRISPR experiment design: from target gene to delivery-ready constructs with branching paths for different editing strategies.
## Workflow Overview
```
Target Gene/Position
|
v
[1. Guide RNA Design] --> CRISPRscan / Rule Set 2 / DeepCRISPR
|
v
[2. Off-Target Assessment] --> Cas-OFFinder + CFD scoring
|
v
Decision Point: What type of edit?
|
+---+-------------------+--------------------+
| | |
v v v
[3a. Knockout] [3b. Base Editing] [3c. Knockin]
Standard Cas9 CBE/ABE design HDR template
Frameshift C>T or A>G with homology arms
| | |
v v v
Final Constructs with Validation Primers
```
## Prerequisites
```bash
pip install crisprscan biopython pandas numpy matplotlib
conda install -c bioconda primer3-py cas-offinder
# Python packages for scoring
pip install crisprtools # if available
```
## Primary Path: Gene Knockout
### Step 1: Guide RNA Design
```python
from Bio import SeqIO
from Bio.Seq import Seq
import pandas as pd
import re
def find_guides(sequence, pam='NGG'):
'''Find all potential gRNA target sites with NGG PAM.'''
guides = []
seq_str = str(sequence).upper()
# Forward strand: 20bp + NGG
for match in re.finditer(r'(?=([ATCG]{20}[ATCG]GG))', seq_str):
pos = match.start()
target = match.group(1)[:20]
pam_seq = match.group(1)[20:23]
guides.append({
'sequence': target,
'pam': pam_seq,
'position': pos,
'strand': '+',
'full_target': match.group(1)
})
# Reverse strand: CCN + 20bp
for match in re.finditer(r'(?=(CC[ATCG][ATCG]{20}))', seq_str):
pos = match.start()
full = match.group(1)
target = str(Seq(full[3:23]).reverse_complement())
pam_seq = str(Seq(full[0:3]).reverse_complement())
guides.append({
'sequence': target,
'pam': pam_seq,
'position': pos,
'strand': '-',
'full_target': full
})
return pd.DataFrame(guides)
def score_guide(guide_seq):
'''Score guide using Rule Set 2-like heuristics.'''
score = 0.5 # Base score
# GC content (optimal: 40-70%)
gc = (guide_seq.count('G') + guide_seq.count('C')) / len(guide_seq)
if 0.4 <= gc <= 0.7:
score += 0.2
elif gc < 0.3 or gc > 0.8:
score -= 0.2
# No poly-T (>4 T's is Pol III terminator)
if 'TTTT' in guide_seq:
score -= 0.3
# G at position 20 (adjacent to PAM) preferred
if guide_seq[-1] == 'G':
score += 0.1
# Avoid GG at positions 19-20
if guide_seq[-2:] == 'GG':
score -= 0.1
# Seed region (positions 12-20) GC
seed = guide_seq[11:20]
seed_gc = (seed.count('G') + seed.count('C')) / len(seed)
if 0.4 <= seed_gc <= 0.7:
score += 0.1
return min(1.0, max(0.0, score))
# Example: Design guides for BRCA1 exon
gene_seq = '''ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGT
GTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTG'''
guides = find_guides(gene_seq.replace('\n', ''))
guides['activity_score'] = guides['sequence'].apply(score_guide)
# Filter high-scoring guides
# Activity score >0.6 is standard threshold for reliable editing
good_guides = guides[guides['activity_score'] > 0.6].sort_values('activity_score', ascending=False)
print(f'Found {len(good_guides)} high-scoring guides')
print(good_guides[['sequence', 'position', 'strand', 'activity_score']].head(10))
```
### Step 2: Off-Target Assessment
```python
import subprocess
from pathlib import Path
def run_cas_offinder(guides_df, genome_fasta, output_dir, max_mismatches=4):
'''Run Cas-OFFinder for off-target detection.'''
output_dir = Path(output_dir)
output_dir.mkdir(parents=True, exist_ok=True)
# Write input file
input_file = output_dir / 'cas_offinder_input.txt'
with open(input_file, 'w') as f:
f.write(f'{genome_fasta}\n')
f.write('NNNNNNNNNNNNNNNNNNNNNGG\n') # 20bp + NGG pattern
for _, row in guides_df.iterrows():
f.write(f"{row['sequence']}NNN {max_mismatches}\n")
# Run Cas-OFFinder
output_file = output_dir / 'offtargets.txt'
subprocess.run([
'cas-offinder', str(input_file), 'C', str(output_file) # C for CPU
], check=True)
# Parse results
offtargets = pd.read_csv(output_file, sep='\t', header=None,
names=['pattern', 'chromosome', 'position', 'target',
'strand', 'mismatches'])
return offtargets
def calculate_specificity_score(guide_seq, offtargets_df):
'''Calculate CFD-based specificity score.'''
# Simplified: penalize based on mismatch count and position
guide_offtargets = offtargets_df[offtargets_df['pattern'].str.contains(guide_seq[:10])]
if len(guide_offtargets) == 0:
return 1.0
# Weight by mismatch count (more mismatches = lower penalty)
penalty = 0
for _, ot in guide_offtargets.iterrows():
mm = ot['mismatches']
if mm == 0: # Perfect match elsewhere (bad!)
penalty += 1.0
elif mm == 1:
penalty += 0.5
elif mm == 2:
penalty += 0.2
elif mm == 3:
penalty += 0.1
else:
penalty += 0.05
# Specificity score: higher is better
# Score >0.7 is generally acceptable
return max(0, 1 - penalty / 10)
# Filter by off-target profile
good_guides['specificity_score'] = good_guides['sequence'].apply(
lambda x: calculate_specificity_score(x, pd.DataFrame()) # placeholder
)
# Combined score
good_guides['combined_score'] = (good_guides['activity_score'] * 0.5 +
good_guides['specificity_score'] * 0.5)
final_guides = good_guides.sort_values('combined_score', ascending=False).head(5)
```
### Step 3a: Knockout Design (Frameshift)
```python
def design_knockout(guide_row, target_sequence):
'''Design knockout experiment with validation primers.'''
guide_seq = guide_row['sequence']
position = guide_row['position']
# Cas9 cuts 3bp upstream of PAM
cut_site = position + 17 if guide_row['strand'] == '+' else position + 6
# Validation primers flanking cut site (~200bp amplicon)
# 200bp amplicon is optimal for detecting indels by gel or Sanger
left_start = max(0, cut_site - 100)
right_end = min(len(target_sequence), cut_site + 100)
return {
'guide_sequence': guide_seq,
'pam': guide_row['pam'],
'cut_site': cut_site,
'expected_outcome': 'Frameshift indel',
'validation_amplicon_start': left_start,
'validation_amplicon_end': right_end
}
ko_design = design_knockout(final_guides.iloc[0], gene_seq.replace('\n', ''))
print('Knockout Design:')
for k, v in ko_design.items():
print(f' {k}: {v}')
```
### Step 3b: Base Editing Design (CBE/ABE)
```python
def design_base_edit(target_position, target_sequence, edit_type='CBE'):
'''Design base editing experiment.
CBE: C>T conversion (or G>A on opposite strand)
ABE: A>G conversion (or T>C on opposite strand)
Editing window: positions 4-8 in the protospacer (counting from PAM-distal)
'''
guides = find_guides(target_sequence)
suitable_guides = []
for _, guide in guides.iterrows():
guide_start = guide['position']
guide_end = guide_start + 20
# Check if target position falls in editing window (positions 4-8)
# Window position 4-8 is optimal for BE3/BE4 (CBE) and ABE7.10/ABE8
if guide['strand'] == '+':
window_start = guide_start + 3 # Position 4
window_end = guide_start + 8 # Position 8
else:
window_start = guide_end - 8
window_end = guide_end - 3
if window_start <= target_position <= window_end:
# Check if target base is appropriate
target_base = target_sequence[target_position].upper()
if edit_type == 'CBE' and target_base in ['C', 'G']:
suitable_guides.append(guide)
elif edit_type == 'ABE' and target_base in ['A', 'T']:
suitable_guides.append(guide)
return pd.DataFrame(suitable_guides)
# Example: Design CBE to introduce stop codon
# C>T at specific position can create TAG/TAA/TGA stop
target_pos = 45 # Example position with C
cbe_guides = design_base_edit(target_pos, gene_seq.replace('\n', ''), 'CBE')
print(f'Found {len(cbe_guides)} CBE-compatible guides')
```
### Step 3c: Knockin Design (HDR Template)
```python
def design_hdr_template(guide_row, target_sequence, insert_sequence,
homology_arm_length=800):
'''Design HDR donor template with homology arms.
Homology arm length: 800bp is standard for plasmid donors.
For ssODN, use 30-60bp arms.
'''
cut_site = guide_row['position'] + 17 if guide_row['strand'] == '+' else guide_row['position'] + 6
# Extract homology arms
# Arms flank the cut site
left_arm_start = max(0, cut_site - homology_arm_length)
left_arm = target_sequence[left_arm_start:cut_site]
right_arm_end = min(len(target_sequence), cut_site + homology_arm_length)
right_arm = target_sequence[cut_site:right_arm_end]
# Mutate PAM in donor to prevent re-cutting
# Change NGG to NGA or NAG (silent if possible)
guide_seq = guide_row['sequence']
pam_position_in_arms = cut_site - left_arm_start + 3
# Full donor: left_arm + insert + right_arm
donor = left_arm + insert_sequence + right_arm
return {
'guide_sequence': guide_seq,
'cut_site': cut_site,
'left_arm': left_arm,
'right_arm': right_arm,
'insert': insert_sequence,
'donor_template': donor,
'donor_length': len(donor),
'note': 'Remember to mutate PAM in donor to prevent re-cutting'
}
# Example: Insert GFP tag
gfp_sequence = 'ATGGTGAGCAAGGGCGAGGAG...' # Truncated for example
hdr_design = design_hdr_template(final_guides.iloc[0], gene_seq.replace('\n', ''), 'FLAG_TAG', 50)
print('HDR Design:')
print(f" Left arm length: {len(hdr_design['left_arm'])}")
print(f" Right arm length: {len(hdr_design['right_arm'])}")
print(f" Total donor length: {hdr_design['donor_length']}")
```
## Visualization
```python
import matplotlib.pyplot as plt
import matplotlib.patches as mpatches
import numpy as np
def plot_guide_landscape(guides_df, gene_length, exon_coords=None):
'''Visualize guide positions and scores along gene.'''
fig, axes = plt.subplots(2, 1, figsize=(14, 6), gridspec_kw={'height_ratios': [1, 2]})
# Top: Gene structure
ax1 = axes[0]
ax1.axhline(y=0.5, color='gray', linewidth=10, solid_capstyle='butt')
if exon_coords:
for start, end in exon_coords:
ax1.axhline(y=0.5, xmin=start/gene_length, xmax=end/gene_length,
color='steelblue', linewidth=20, solid_capstyle='butt')
ax1.set_xlim(0, gene_length)
ax1.set_ylim(0, 1)
ax1.set_ylabel('Gene')
ax1.set_xticks([])
ax1.set_yticks([])
# Bottom: Guide scores
ax2 = axes[1]
colors = ['green' if s > 0.6 else 'orange' if s > 0.4 else 'red'
for s in guides_df['activity_score']]
ax2.scatter(guides_df['position'], guides_df['activity_score'],
c=colors, s=50, alpha=0.7)
ax2.axhline(y=0.6, color='green', linestyle='--', alpha=0.5, label='Threshold')
ax2.set_xlim(0, gene_length)
ax2.set_ylim(0, 1)
ax2.set_xlabel('Position (bp)')
ax2.set_ylabel('Activity Score')
ax2.legend()
plt.tight_layout()
plt.savefig('guide_landscape.pdf')
return fig
# Plot
plot_guide_landscape(guides, len(gene_seq.replace('\n', '')),
exon_coords=[(0, 50), (70, 130)])
```
## Parameter Recommendations
| Step | Parameter | Value | Rationale |
|------|-----------|-------|-----------|
| Guide design | Activity score | >0.6 | Standard threshold for reliable editing |
| Guide design | GC content | 40-70% | Optimal for binding and Cas9 activity |
| Off-target | Max mismatches | 4 | Catches most relevant off-targets |
| Off-target | Specificity score | >0.7 | Acceptable off-target profile |
| Base editing | Window | positions 4-8 | Optimal for BE3/BE4, ABE7.10 |
| HDR | Homology arms | 800bp | Standard for plasmid donors |
| HDR (ssODN) | Homology arms | 30-60bp | For single-strand oligo donors |
## Troubleshooting
| Issue | Likely Cause | Solution |
|-------|--------------|----------|
| No high-scoring guides | GC-poor region | Expand search region, consider Cas12a |
| Many off-targets | Repetitive sequence | Use high-fidelity Cas9 (eSpCas9, HiFi) |
| Low HDR efficiency | NHEJ dominant | Add NHEJ inhibitors, use ssODN |
| Base editing outside window | Guide position | Redesign with target in positions 4-8 |
| Bystander edits | Multiple C/A in window | Design guides with single target base |
## Output Files
| File | Description |
|------|-------------|
| `guides_ranked.tsv` | All guides with activity and specificity scores |
| `offtargets.txt` | Cas-OFFinder results |
| `knockout_design.json` | KO guide and validation primers |
| `base_edit_design.json` | CBE/ABE design with editing window |
| `hdr_template.fasta` | Donor template sequence |
| `guide_landscape.pdf` | Visualization of guide positions |
## Related Skills
- genome-engineering/grna-design - Detailed scoring algorithms
- genome-engineering/off-target-prediction - Cas-OFFinder and CFD
- genome-engineering/base-editing-design - CBE/ABE specifics
- genome-engineering/prime-editing-design - pegRNA design
- genome-engineering/hdr-template-design - Donor optimization
- primer-design/primer-basics - Validation primer design
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!