--> --- name: crispr-guide-design description: Guide foundry keywords: - CRISPR - sgRNA - Doench - off-target - oligos measurable_outcome: Return the requested number of guides (default ≥4) with efficiency + specificity scores, coordinates, and cloning oligos within 10 minutes per gene. license: MIT metadata: author: CRISPR-GPT Team version: "1.0.0" compatibility: - system: Python 3.10+ allowed-tools: - run_shell_command - read_file --- Automate sgRNA selection, scoring, off-target evaluation...
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill CRISPR_Design_Agent --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of CRISPR Design Agent?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-crispr-design-agent-ai-agentic-skills-by-dr-mia)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: crispr-guide-design
description: Guide foundry
keywords:
- CRISPR
- sgRNA
- Doench
- off-target
- oligos
measurable_outcome: Return the requested number of guides (default ≥4) with efficiency + specificity scores, coordinates, and cloning oligos within 10 minutes per gene.
license: MIT
metadata:
author: CRISPR-GPT Team
version: "1.0.0"
compatibility:
- system: Python 3.10+
allowed-tools:
- run_shell_command
- read_file
---
# CRISPR Design Agent
Automate sgRNA selection, scoring, off-target evaluation, and oligo generation for CRISPR experiments using the documented workflow.
## When to Use
- Designing CRISPR knockout/knock-in experiments that need validated guides.
- Locating all PAM-compatible target sites in a gene or locus.
- Filtering guides by efficiency/off-target metrics before cloning.
## Core Capabilities
1. **Target discovery:** Scan sequences for PAM motifs (e.g., NGG).
2. **Efficiency scoring:** Evaluate GC content, homopolymers, Doench/DeepCRISPR/CFD scores.
3. **Filtering & ranking:** Remove risky guides (SNP overlap, off-target hits) and output the best candidates.
## Workflow
1. Resolve gene symbol + organism to canonical transcript coordinates and target region.
2. Enumerate PAM-compatible sites; extract spacers for the chosen Cas variant.
3. Score guides (efficiency + specificity) and compute GC metrics.
4. Run off-target search (≤3 mismatches) to flag problematic loci.
5. Filter/rank guides, generate cloning oligos/primers, and emit JSON/CSV outputs with coordinates.
## Example Usage
```bash
python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
--sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
--output guides.json
```
## Guardrails
- Always state genome build and Cas variant assumptions.
- Avoid guides overlapping common SNPs when `avoid_variants` is true.
- Flag high off-target density near coding regions for manual review.
## References
- See `README.md` and `prompt.md` for detailed schema plus supporting literature.
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!