--> --- name: bio-clip-seq-clip-preprocessing description: Preprocess CLIP-seq data including adapter trimming, UMI extraction, and PCR duplicate removal. Use when preparing raw CLIP, iCLIP, or eCLIP reads for peak calling. tool_type: cli primary_tool: umi_tools measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command ---
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill clip-preprocessing --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Clip Preprocessing?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-clip-preprocessing)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-clip-seq-clip-preprocessing
description: Preprocess CLIP-seq data including adapter trimming, UMI extraction, and PCR duplicate removal. Use when preparing raw CLIP, iCLIP, or eCLIP reads for peak calling.
tool_type: cli
primary_tool: umi_tools
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# CLIP-seq Preprocessing
## UMI Extraction (eCLIP/iCLIP)
```bash
# Extract UMI from read 1
umi_tools extract \
--stdin=reads_R1.fastq.gz \
--read2-in=reads_R2.fastq.gz \
--bc-pattern=NNNNNNNNNN \
--stdout=R1_umi.fastq.gz \
--read2-out=R2_umi.fastq.gz
# bc-pattern: UMI barcode pattern
# N = UMI base
# For eCLIP: typically 10-nt UMI in read 1
```
## Adapter Trimming
```bash
# Trim adapters after UMI extraction
cutadapt \
-a AGATCGGAAGAGCACACGTCT \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-m 18 \
-o trimmed_R1.fastq.gz \
-p trimmed_R2.fastq.gz \
R1_umi.fastq.gz R2_umi.fastq.gz
```
## Two-Pass Trimming (eCLIP)
```bash
# eCLIP protocol has inline adapters
# First pass: trim 3' adapter
cutadapt -a AGATCGGAAGAGC -m 18 -o pass1.fq.gz input.fq.gz
# Second pass: trim 5' adapter (read-through)
cutadapt -g AGATCGGAAGAGC -m 18 -o pass2.fq.gz pass1.fq.gz
```
## PCR Duplicate Removal
```bash
# After alignment, deduplicate using UMIs
umi_tools dedup \
--stdin=aligned.bam \
--stdout=deduped.bam \
--paired \
--method=unique
# Methods:
# unique: Exact UMI match
# cluster: Allow UMI mismatches (default)
# adjacency: Network-based clustering
```
## Python Preprocessing
```python
from umi_tools import UMIClusterer
import pysam
def count_umis_per_position(bam_path):
'''Count unique UMIs at each genomic position'''
from collections import defaultdict
position_umis = defaultdict(set)
with pysam.AlignmentFile(bam_path, 'rb') as bam:
for read in bam:
if read.is_unmapped:
continue
# Extract UMI from read name (added by umi_tools extract)
umi = read.query_name.split('_')[-1]
pos = (read.reference_name, read.reference_start)
position_umis[pos].add(umi)
return {pos: len(umis) for pos, umis in position_umis.items()}
```
## Quality Control
```python
def clip_qc(bam_path):
'''CLIP-seq specific QC metrics'''
import pysam
total = 0
unique_positions = set()
read_lengths = []
with pysam.AlignmentFile(bam_path, 'rb') as bam:
for read in bam:
if read.is_unmapped:
continue
total += 1
unique_positions.add((read.reference_name, read.reference_start))
read_lengths.append(read.query_length)
return {
'total_reads': total,
'unique_positions': len(unique_positions),
'mean_read_length': sum(read_lengths) / len(read_lengths),
'complexity': len(unique_positions) / total
}
```
## Related Skills
- clip-alignment - Align preprocessed reads
- read-qc/umi-processing - General UMI handling
- clip-peak-calling - Call peaks from aligned reads
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!