--> --- name: bio-workflows-clip-pipeline description: End-to-end CLIP-seq analysis from FASTQ to binding sites and motif enrichment. Use when analyzing protein-RNA interactions from CLIP-based methods. tool_type: mixed primary_tool: CLIPper measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command ---
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill clip-pipeline --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Clip Pipeline?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-clip-pipeline-ai-agentic-skills-by-dr-mia)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-workflows-clip-pipeline
description: End-to-end CLIP-seq analysis from FASTQ to binding sites and motif enrichment. Use when analyzing protein-RNA interactions from CLIP-based methods.
tool_type: mixed
primary_tool: CLIPper
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# CLIP-seq Pipeline
## Pipeline Overview
```
FASTQ → QC → UMI extract → Trim adapters → Align → Filter → Dedup → Peak call → Annotate → Motifs
```
## CLIP Method Variants
| Method | UMI | Crosslink Site | Adapter |
|--------|-----|----------------|---------|
| HITS-CLIP | Optional | Deletions | 3' adapter |
| PAR-CLIP | Optional | T→C mutations | 3' adapter |
| iCLIP | Required | 5' of read | 3' adapter |
| eCLIP | Required | 5' of read | 3' adapter |
## Step 1: Quality Control
```bash
# Initial QC
fastqc reads.fastq.gz -o qc_pre/
# Check for adapter contamination and UMI structure
# For eCLIP: expect 10nt UMI at read start
zcat reads.fastq.gz | head -n 100 | cut -c1-15
```
## Step 2: UMI Extraction
```bash
# eCLIP (10nt UMI at 5' end)
umi_tools extract \
--stdin=reads.fastq.gz \
--bc-pattern=NNNNNNNNNN \
--stdout=extracted.fastq.gz \
--log=umi_extract.log
# iCLIP (5nt experimental barcode + 5nt UMI)
umi_tools extract \
--stdin=reads.fastq.gz \
--bc-pattern=NNNNNXXXXX \
--stdout=extracted.fastq.gz
```
## Step 3: Adapter Trimming
```bash
# Trim 3' adapter (common eCLIP adapter)
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
--minimum-length 20 \
--quality-cutoff 20 \
-o trimmed.fastq.gz \
extracted.fastq.gz
# For paired UMI adapters
cutadapt -a AGATCGGAAGAGCACACGTCT \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
--minimum-length 20 \
-o trimmed_R1.fq.gz -p trimmed_R2.fq.gz \
extracted_R1.fq.gz extracted_R2.fq.gz
```
## Step 4: Alignment
```bash
# Build STAR index (once)
STAR --runMode genomeGenerate \
--genomeDir star_index \
--genomeFastaFiles genome.fa \
--sjdbGTFfile genes.gtf \
--sjdbOverhang 100
# Align with STAR (optimized for short CLIP reads)
STAR --genomeDir star_index \
--readFilesIn trimmed.fastq.gz \
--readFilesCommand zcat \
--outFilterMismatchNmax 2 \
--outFilterMultimapNmax 1 \
--outSAMtype BAM SortedByCoordinate \
--outSAMattributes All \
--alignEndsType EndToEnd \
--outFileNamePrefix clip_
```
## Step 5: Alignment Filtering
```bash
# Remove unmapped and low-quality reads
samtools view -b -F 4 -q 10 clip_Aligned.sortedByCoord.out.bam > filtered.bam
samtools index filtered.bam
# Optional: remove reads mapping to rRNA/tRNA
bedtools intersect -v -abam filtered.bam -b rrna_trna.bed > filtered_norRNA.bam
```
## Step 6: PCR Deduplication
```bash
# UMI-aware deduplication
umi_tools dedup \
-I filtered.bam \
-S dedup.bam \
--output-stats=dedup_stats
samtools index dedup.bam
# Check deduplication rate
echo "Duplication rate:" $(grep "Input Reads" dedup_stats.log | awk '{print $3}')
```
## Step 7: Peak Calling
```bash
# CLIPper (recommended)
clipper -b dedup.bam -s hg38 -o peaks.bed --FDR 0.05 --superlocal
# Alternative: Piranha
Piranha -s dedup.bam -o piranha_peaks.bed -p 0.01
# For PAR-CLIP with T→C mutations
PARalyzer settings.ini
# Strand-specific calling
samtools view -h -F 16 dedup.bam | samtools view -Sb - > plus.bam
samtools view -h -f 16 dedup.bam | samtools view -Sb - > minus.bam
clipper -b plus.bam -s hg38 -o peaks_plus.bed
clipper -b minus.bam -s hg38 -o peaks_minus.bed
cat peaks_plus.bed peaks_minus.bed | sort -k1,1 -k2,2n > peaks_stranded.bed
```
## Step 8: Peak Annotation
```bash
# Annotate with gene features
bedtools intersect -a peaks.bed -b genes.gtf -wo > peaks_annotated.txt
# Or use HOMER
annotatePeaks.pl peaks.bed hg38 > peaks_homer_annotated.txt
# Feature distribution
awk -F'\t' '{print $8}' peaks_homer_annotated.txt | sort | uniq -c | sort -rn
```
## Step 9: Motif Analysis
```bash
# Extract peak sequences
bedtools getfasta -fi genome.fa -bed peaks.bed -s -fo peaks.fa
# HOMER motif finding (RNA mode)
findMotifs.pl peaks.fa fasta motif_output -rna -len 5,6,7,8 -p 8
# MEME-ChIP
meme-chip -oc meme_output -dna peaks.fa -meme-mod zoops -meme-nmotifs 10
```
## Step 10: Cross-link Site Analysis
```bash
# For iCLIP/eCLIP: identify crosslink sites (read 5' ends)
bedtools genomecov -ibam dedup.bam -bg -5 -strand + > crosslinks_plus.bg
bedtools genomecov -ibam dedup.bam -bg -5 -strand - > crosslinks_minus.bg
# For PAR-CLIP: identify T→C conversion sites
# Requires specialized tools like PARpipe
```
## Quality Checkpoints
| Step | Metric | Expected |
|------|--------|----------|
| Raw | Read count | >10M |
| Trimmed | Reads >20bp | >80% |
| Aligned | Mapping rate | >50% |
| Dedup | Unique rate | >20% |
| Peaks | Peak count | 1,000-50,000 |
| Peaks | Median width | 20-100 nt |
| FRiP | Reads in peaks | >10% |
```bash
# Calculate FRiP
reads_in_peaks=$(bedtools intersect -a dedup.bam -b peaks.bed -u | samtools view -c -)
total_reads=$(samtools view -c dedup.bam)
frip=$(echo "scale=4; $reads_in_peaks / $total_reads" | bc)
echo "FRiP: $frip"
```
## Complete Pipeline Script
```bash
#!/bin/bash
set -euo pipefail
SAMPLE=$1
READS=$2
GENOME_DIR=$3
GENOME_FA=$4
mkdir -p qc trimmed aligned peaks motifs
# QC
fastqc $READS -o qc/
# UMI extract
umi_tools extract --stdin=$READS --bc-pattern=NNNNNNNNNN \
--stdout=trimmed/${SAMPLE}_extracted.fq.gz
# Trim
cutadapt -a AGATCGGAAGAGCACACGTCT --minimum-length 20 \
-o trimmed/${SAMPLE}_trimmed.fq.gz trimmed/${SAMPLE}_extracted.fq.gz
# Align
STAR --genomeDir $GENOME_DIR --readFilesIn trimmed/${SAMPLE}_trimmed.fq.gz \
--readFilesCommand zcat --outFilterMismatchNmax 2 --outFilterMultimapNmax 1 \
--outSAMtype BAM SortedByCoordinate --outFileNamePrefix aligned/${SAMPLE}_
# Filter and dedup
samtools view -b -F 4 -q 10 aligned/${SAMPLE}_Aligned.sortedByCoord.out.bam | \
samtools sort -o aligned/${SAMPLE}_filtered.bam
samtools index aligned/${SAMPLE}_filtered.bam
umi_tools dedup -I aligned/${SAMPLE}_filtered.bam -S aligned/${SAMPLE}_dedup.bam
samtools index aligned/${SAMPLE}_dedup.bam
# Peaks
clipper -b aligned/${SAMPLE}_dedup.bam -s hg38 -o peaks/${SAMPLE}_peaks.bed
# Motifs
bedtools getfasta -fi $GENOME_FA -bed peaks/${SAMPLE}_peaks.bed -s -fo peaks/${SAMPLE}.fa
findMotifs.pl peaks/${SAMPLE}.fa fasta motifs/${SAMPLE} -rna -len 5,6,7 -p 4
echo "Pipeline complete for $SAMPLE"
```
## Related Skills
- clip-seq/clip-preprocessing - Detailed preprocessing
- clip-seq/clip-alignment - Alignment optimization
- clip-seq/clip-peak-calling - Peak caller comparison
- clip-seq/binding-site-annotation - Feature annotation
- clip-seq/clip-motif-analysis - Motif discovery
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!