Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
Scanned 2/12/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/LLMs-Universal-Life-Science-and-Clinical-Skills- --skill base-editing-analysis --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Base Editing Analysis?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-base-editing-analysis)More formats (shields.io, HTML) on the badges page.
---
name: bio-crispr-screens-base-editing-analysis
description: Analyzes base editing and prime editing outcomes including editing efficiency, bystander edits, and indel frequencies. Use when quantifying CRISPR base editor results, comparing ABE vs CBE efficiency, or assessing prime editing fidelity.
tool_type: python
primary_tool: CRISPResso2
---
# Base Editing Analysis
## CRISPResso2 for Base Editing
```bash
# Analyze base editing with expected outcome
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq ATGCGATCGATCGATCGATCGATCG \
--guide_seq TCGATCGATCGATCGAT \
--expected_hdr_amplicon_seq ATGCGATCGATCGTTCGATCGATCG \
--base_editor_output \
-o results/
```
## Key Metrics
| Metric | Description |
|--------|-------------|
| Editing efficiency | % reads with target base change |
| Bystander edits | Unintended edits in editing window |
| Indel frequency | Insertions/deletions (should be low) |
| Purity | Target edit without bystanders |
## Base Editor Types
### Cytosine Base Editors (CBE)
```bash
# C->T conversion (or G->A on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $GUIDE \
--base_editor_output \
--conversion_nuc_from C \
--conversion_nuc_to T
```
### Adenine Base Editors (ABE)
```bash
# A->G conversion (or T->C on opposite strand)
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $GUIDE \
--base_editor_output \
--conversion_nuc_from A \
--conversion_nuc_to G
```
## Prime Editing Analysis
```bash
# Prime editing with pegRNA
CRISPResso --fastq_r1 reads.fq.gz \
--amplicon_seq $AMPLICON \
--guide_seq $SPACER \
--expected_hdr_amplicon_seq $EDITED_AMPLICON \
--prime_editing_pegRNA_extension_seq $EXTENSION \
-o prime_edit_results/
```
## Editing Window Analysis
```python
import pandas as pd
# Load CRISPResso quantification
quant = pd.read_csv('CRISPResso_output/Quantification_window_nucleotide_percentage_table.txt',
sep='\t')
# Calculate per-position editing
editing_window = quant[(quant['Position'] >= -5) & (quant['Position'] <= 5)]
```
## Quality Thresholds
- Editing efficiency: >30% considered good for most applications
- Indel rate: <5% ideal for base editors
- Bystander rate: depends on application; <10% often acceptable
## Related Skills
- crispr-screens/crispresso-editing - General editing QC
- crispr-screens/library-design - Guide design considerations
- variant-calling/vcf-basics - Downstream variant analysis
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!