--> --- name: bio-read-qc-adapter-trimming description: Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads. tool_type: cli primary_tool: cutadapt measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command --- Remov...
Scanned 9/8/2026
Install to Claude Code
npx -y skills add mdbabumiamssm/AI-Agentic-Skills-by-Dr.-Mia --skill adapter-trimming --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Adapter Trimming?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/mdbabumiamssm-adapter-trimming-ai-agentic-skills-by-dr-mia)More formats (shields.io, HTML) on the badges page.
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal AI Agentic Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
---
name: bio-read-qc-adapter-trimming
description: Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
tool_type: cli
primary_tool: cutadapt
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
# Adapter Trimming
Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).
## Common Adapter Sequences
| Platform/Kit | Adapter | Sequence |
|--------------|---------|----------|
| Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| Nextera | Transposase | CTGTCTCTTATACACATCT |
| Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG |
| Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |
## Cutadapt
### Single-End Reads
```bash
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz
# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz
# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz
# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
```
### Paired-End Reads
```bash
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
-A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
-o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
sample_R1.fastq.gz sample_R2.fastq.gz
```
### Adapter Options
```bash
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq
# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq
# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq
# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq
# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
```
### Linked Adapters
```bash
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq
# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
```
### Filtering After Trimming
```bash
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq
# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq
# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq
# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq
# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
```
### Paired-End Filtering
```bash
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
--too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
-o R1.fq -p R2.fq in_R1.fq in_R2.fq
```
### Action Options
```bash
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq
# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq
# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
```
## Trimmomatic
### Single-End Mode
```bash
trimmomatic SE -phred33 \
input.fastq.gz output.fastq.gz \
ILLUMINACLIP:adapters.fa:2:30:10
```
### Paired-End Mode
```bash
trimmomatic PE -phred33 -threads 4 \
input_R1.fastq.gz input_R2.fastq.gz \
output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
```
### ILLUMINACLIP Parameters
```bash
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>
# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)
# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
```
### Built-in Adapter Files
Trimmomatic includes adapter files:
- `TruSeq2-SE.fa` - TruSeq v2 single-end
- `TruSeq2-PE.fa` - TruSeq v2 paired-end
- `TruSeq3-SE.fa` - TruSeq v3 single-end
- `TruSeq3-PE.fa` - TruSeq v3 paired-end
- `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode)
- `NexteraPE-PE.fa` - Nextera paired-end
### Find Trimmomatic Adapters
```bash
# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/
# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
```
## Performance
```bash
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq
# Trimmomatic threads
trimmomatic PE -threads 8 ...
```
## Verify Trimming
```bash
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz
# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
```
## Related Skills
- quality-reports - Check adapter content with FastQC
- quality-filtering - Quality trimming after adapter removal
- fastp-workflow - Combined adapter and quality trimming
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!