Runs all-in-one FASTQ preprocessing with fastp in a single pass - adapter trimming via paired-end overlap analysis, quality/length filtering, 2-color poly-G removal, base correction, optional dedup/UMI/merge, and HTML/JSON reports. Use when preprocessing bulk Illumina data and wanting one fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps. For precise small-RNA/amplicon adapters use adapter-trimming; for molecule-accurate UMI dedup use umi-processing.
Scanned 9/6/2026
Install to Claude Code
npx -y skills add GPTomics/bioSkills --skill fastp-workflow --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Fastp Workflow?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/gptomics-fastp-workflow)More formats (shields.io, HTML) on the badges page.
---
name: bio-read-qc-fastp-workflow
description: Runs all-in-one FASTQ preprocessing with fastp in a single pass - adapter trimming via paired-end overlap analysis, quality/length filtering, 2-color poly-G removal, base correction, optional dedup/UMI/merge, and HTML/JSON reports. Use when preprocessing bulk Illumina data and wanting one fast tool instead of separate Cutadapt, Trimmomatic, and FastQC steps. For precise small-RNA/amplicon adapters use adapter-trimming; for molecule-accurate UMI dedup use umi-processing.
tool_type: cli
primary_tool: fastp
---
## Version Compatibility
Reference examples tested with: fastp 0.23+, FastQC 0.12+, MultiQC 1.21+
Before using code patterns, verify installed versions match. If versions differ:
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
- Python: `pip show <package>` then `help(module.function)` to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# fastp Workflow -- one C++ pass for adapter, quality, poly-G, and QC
Run adapter trimming, quality/length filtering, poly-G removal, and reporting in a single fast pass.
**"Preprocess my reads with fastp"** -> Trim adapters from the read overlap, filter low-quality reads, remove 2-color poly-G, and emit an HTML/JSON report.
- CLI: `fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz -h report.html -j report.json`
Scope: this skill OWNS general-purpose single-pass Illumina preprocessing. Precise small-RNA/amplicon/anchored adapters -> read-qc/adapter-trimming. Molecule-accurate UMI dedup/consensus -> read-qc/umi-processing. DNA coordinate dedup -> alignment-files/duplicate-handling. OUT OF SCOPE: transcriptome QC (read-qc/rnaseq-qc).
## The Single Most Important Modern Insight
1. **fastp trims paired-end adapters by OVERLAP ANALYSIS, needing no adapter sequence at all.** It aligns R1 against the reverse complement of R2, finds the insert-derived overlap, and trims whatever extends past it (the read-through region) -- so it can trim adapter down to a SINGLE trailing base, where sequence-matching tools need at least 3. The same overlap drives `--correction` (`-c`): where the mates disagree and one base is high-quality and the other very low, fastp overwrites the low-quality base with the high-quality call. This overlap machinery is why fastp is the default bulk PE preprocessor and why it needs no `--adapter_sequence` for standard libraries.
2. **`--dedup` is SEQUENCE-identity deduplication at the FASTQ level -- no coordinates, no UMI -- so it removes BIOLOGICAL duplicates too.** It cannot tell a PCR duplicate from a highly expressed transcript's fragment or a targeted amplicon. NEVER use `--dedup` for RNA-seq quantification, amplicon, or any assay where identical reads are genuine signal. For molecule-accurate removal use UMIs (read-qc/umi-processing); for DNA variant calling use coordinate-based dedup AFTER alignment (alignment-files/duplicate-handling). fastp `--dedup` is for the narrow case of removing exact-duplicate reads from a non-UMI library where that is known to be safe.
3. **Poly-G trimming auto-enables for 2-color instruments (NextSeq/NovaSeq) from the machine ID, because G is the no-signal call.** Leave it on; a high-quality poly-G tail is invisible to the quality filter. One fast pass does adapter + quality + poly-G + filtering + QC report, and the JSON feeds MultiQC -- but fastp does NOT replace cutadapt's precision for small-RNA 3' adapters, amplicon primers, or anchored/linked adapters.
## Tool Positioning
| Need | Use fastp? | Alternative |
|------|-----------|-------------|
| Bulk PE WGS/WES/RNA/cfDNA preprocessing | Yes (default) | -- |
| One pass: trim + filter + poly-G + QC report | Yes | -- |
| Small-RNA 3' adapter + tight length gate | No | cutadapt (read-qc/adapter-trimming) |
| Amplicon / anchored / linked primers | No | cutadapt |
| Molecule counting / ctDNA consensus | Extract only | umi_tools / fgbio (read-qc/umi-processing) |
| RNA-seq molecule dedup | No (`--dedup` is wrong) | UMIs, or do not dedup |
## Core Operations
```bash
# Single-end and paired-end basics
fastp -i in.fq.gz -o out.fq.gz
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz
# Adapter: PE overlap is automatic; --detect_adapter_for_pe ADDS sequence-based detection on top
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --detect_adapter_for_pe
# Manual adapter sequences (SE auto-detects from data by default)
fastp -i in.fq.gz -o out.fq.gz --adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
# Quality FILTER (per-read): base <Q20 unqualified; drop if >40% unqualified or >5 Ns
fastp -i in.fq.gz -o out.fq.gz -q 20 -u 40 -n 5
# Quality TRIM (sliding window from 3', SLIDINGWINDOW analogue) + length gate
fastp -i in.fq.gz -o out.fq.gz --cut_right --cut_window_size 4 --cut_mean_quality 20 -l 36
# 2-color poly-G (auto for NextSeq/NovaSeq); poly-X for 3' poly-A etc.
fastp -i in.fq.gz -o out.fq.gz --trim_poly_g # --poly_g_min_len 10 default
fastp -i in.fq.gz -o out.fq.gz --trim_poly_x
# Overlap base correction (PE only; high-Q mate fixes low-Q base)
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --correction
# Merge overlapping pairs (short inserts: cfDNA, small-RNA, aDNA). Produces THREE streams:
# the merged file is single-end (full insert) and un_R1/un_R2 stay paired -- align them separately
# (merged as SE, un_R1/un_R2 as PE) and combine the BAMs.
fastp -i R1.fq.gz -I R2.fq.gz --merge --merged_out merged.fq.gz -o un_R1.fq.gz -O un_R2.fq.gz
# UMI extraction: fastp moves the inline UMI out of the read before trimming; molecule-accurate
# dedup/consensus still happens AFTER alignment (umi_tools/fgbio), not in fastp
fastp -i R1.fq.gz -I R2.fq.gz -o c_R1.fq.gz -O c_R2.fq.gz --umi --umi_loc read1 --umi_len 8
```
Key flags: `-q` qualified quality (default 15), `-u` unqualified percent limit (40), `-n` N limit (5), `-e` average-quality filter (0=off), `-l` length required (15), `--length_limit` (0=off), `--cut_right/--cut_front/--cut_tail` window cut modes (off by default), `--cut_window_size` (4), `--cut_mean_quality` (Q20), `--thread/-w` (default 3), `-h/-j` HTML/JSON report.
## Complete Workflows
```bash
# Standard Illumina PE (4-color: HiSeq/MiSeq)
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
--detect_adapter_for_pe --cut_right --cut_window_size 4 --cut_mean_quality 20 \
-q 20 -l 36 -w 8 -h sample.html -j sample.json
# NovaSeq / NextSeq (2-color): add poly-G (auto, but explicit for clarity)
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
--detect_adapter_for_pe --trim_poly_g \
--cut_right --cut_window_size 4 --cut_mean_quality 20 -q 20 -l 36 -w 8 \
-h sample.html -j sample.json
# RNA-seq: light trim only (aligner soft-clips; do NOT --dedup), longer min length
fastp -i raw_R1.fq.gz -I raw_R2.fq.gz -o clean_R1.fq.gz -O clean_R2.fq.gz \
--detect_adapter_for_pe -q 20 -l 50 -w 8 -h sample.html -j sample.json
```
## Parsing the JSON report
```python
import json
with open('sample.json') as f:
report = json.load(f)
after = report['summary']['after_filtering']
print(f"reads kept: {after['total_reads']}, Q30: {after['q30_rate']:.2%}")
print(f"duplication: {report['duplication']['rate']:.2%}") # diagnostic only -- do not auto-dedup
```
MultiQC parses fastp JSON directly: `multiqc .` over a directory of `*.json` builds the cohort report (read-qc/quality-reports).
## Common Errors
| Symptom | Cause | Solution |
|---------|-------|----------|
| RNA-seq counts deflated after fastp | Used `--dedup` (sequence dedup removes biological dups) | Drop `--dedup` for RNA-seq; never sequence-dedup expression data |
| Adapter not trimmed (SE) | SE has no overlap; relies on data auto-detect | Pass `--adapter_sequence` explicitly for SE |
| Poly-G remains | 4-color run, or auto-detect missed the instrument | Add `--trim_poly_g` explicitly |
| Small-RNA results poor | fastp overlap is not precise enough for ~22 nt inserts | Use cutadapt with `--discard-untrimmed` (read-qc/adapter-trimming) |
| Over-trimmed RNA-seq | Aggressive `--cut_right` quality | Light trim only; aligner soft-clips (read-qc/quality-filtering) |
| UMI dedup expected but none happened | `--umi` only EXTRACTS; dedup is post-alignment | Extract here, dedup with umi_tools/fgbio after mapping (read-qc/umi-processing) |
## References
Chen S, Zhou Y, Chen Y, Gu J. 2018. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34(17):i884-i890.
Chen S. 2023. Ultrafast one-pass FASTQ data preprocessing, quality control, and deduplication using fastp. iMeta 2(2):e107.
Ewels P, Magnusson M, Lundin S, Kaller M. 2016. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32(19):3047-3048.
## Related Skills
read-qc/adapter-trimming - Precise adapter/primer control for small-RNA and amplicon
read-qc/quality-filtering - Detailed quality/length filtering options and the trim-light evidence base
read-qc/quality-reports - Aggregate fastp JSON across samples with MultiQC
read-qc/umi-processing - Molecule-accurate UMI dedup and consensus after alignment
alignment-files/duplicate-handling - Coordinate-based duplicate marking for DNA variant calling
Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!