End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.
Scanned 9/5/2026
Install to Claude Code
npx -y skills add FridrichMethod/awesome-skills --skill bio-workflows-smrna-pipeline --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Bio Workflows Smrna Pipeline?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/fridrichmethod-bio-workflows-smrna-pipeline)More formats (shields.io, HTML) on the badges page.
---
name: bio-workflows-smrna-pipeline
description: End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.
tool_type: mixed
primary_tool: miRDeep2
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
# Small RNA-seq Pipeline
## Pipeline Overview
```
FASTQ → cutadapt trim → miRDeep2 → Quantification → DESeq2 → Target prediction
```
## Step 1: Preprocessing
```bash
# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
--minimum-length 18 --maximum-length 30 \
-o trimmed.fastq.gz reads.fastq.gz
```
## Step 2: miRDeep2 Analysis
```bash
# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
-m -p genome_index -s reads_collapsed.fa \
-t reads_collapsed_vs_genome.arf
# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
reads_collapsed_vs_genome.arf \
mature_ref.fa none hairpin_ref.fa
```
## Step 3: Differential Expression
```r
library(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)
```
## Step 4: Target Prediction
```bash
# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt
```
## QC Checkpoints
1. **After trimming**: Size distribution should peak at 21-23nt
2. **After alignment**: >70% mapping rate expected
3. **After DE**: Check volcano plot and PCA
## Related Skills
- small-rna-seq/mirdeep2-analysis - Detailed miRDeep2
- small-rna-seq/differential-mirna - DE analysis
- small-rna-seq/target-prediction - Target analysis
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!