Validate PCR primers for specificity, dimers, hairpins, and secondary structures using primer3-py thermodynamic calculations. Check self-complementarity, heterodimer formation, and 3' stability. Use when validating primer specificity and properties.
Scanned 9/5/2026
Install to Claude Code
npx -y skills add FridrichMethod/awesome-skills --skill bio-primer-design-primer-validation --agent claude-codeInstalls into .claude/skills of the current project.
Are you the author of Bio Primer Design Primer Validation?
Add the live security badge to your README — it updates automatically with every re-scan.
[](https://www.skillsdirectory.com/skills/fridrichmethod-bio-primer-design-primer-validation)More formats (shields.io, HTML) on the badges page.
---
name: bio-primer-design-primer-validation
description: Validate PCR primers for specificity, dimers, hairpins, and secondary structures using primer3-py thermodynamic calculations. Check self-complementarity, heterodimer formation, and 3' stability. Use when validating primer specificity and properties.
tool_type: python
primary_tool: primer3-py
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
- read_file
- run_shell_command
---
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA
-->
# Primer Validation
Check primers for secondary structures, dimers, and other issues using primer3-py.
## Required Imports
```python
import primer3
```
## Check Hairpin Formation
```python
primer = 'ATGCGATCGATCGATCGATC'
hairpin = primer3.calc_hairpin(primer)
print(f'Hairpin Tm: {hairpin.tm:.1f}C')
print(f'Hairpin dG: {hairpin.dg:.1f} cal/mol')
print(f'Hairpin dH: {hairpin.dh:.1f} cal/mol')
print(f'Hairpin dS: {hairpin.ds:.1f} cal/mol/K')
# Hairpin is problematic if Tm > annealing temp - 10
annealing_temp = 60.0
if hairpin.tm > annealing_temp - 10:
print(f'WARNING: Hairpin Tm too high for annealing at {annealing_temp}C')
```
## Check Self-Dimer (Homodimer)
```python
primer = 'ATGCGATCGATCGATCGATC'
homodimer = primer3.calc_homodimer(primer)
print(f'Homodimer Tm: {homodimer.tm:.1f}C')
print(f'Homodimer dG: {homodimer.dg:.1f} cal/mol')
# Self-dimer is problematic if Tm is close to annealing temp
if homodimer.tm > 40:
print('WARNING: Significant self-dimer potential')
```
## Check Primer-Primer Dimer (Heterodimer)
```python
forward = 'ATGCGATCGATCGATCGATC'
reverse = 'GCTAGCTAGCTAGCTAGCTA'
heterodimer = primer3.calc_heterodimer(forward, reverse)
print(f'Heterodimer Tm: {heterodimer.tm:.1f}C')
print(f'Heterodimer dG: {heterodimer.dg:.1f} cal/mol')
if heterodimer.tm > 40:
print('WARNING: Significant primer dimer potential between forward and reverse')
```
## Complete Primer Validation
```python
def validate_primer(primer_seq, name='Primer', annealing_temp=60.0):
'''Comprehensive primer validation'''
print(f'\n=== Validating {name}: {primer_seq} ===')
# Basic properties
tm = primer3.calc_tm(primer_seq)
gc = (primer_seq.count('G') + primer_seq.count('C')) / len(primer_seq) * 100
print(f'Length: {len(primer_seq)}bp')
print(f'Tm: {tm:.1f}C')
print(f'GC: {gc:.1f}%')
# Hairpin
hairpin = primer3.calc_hairpin(primer_seq)
print(f'Hairpin Tm: {hairpin.tm:.1f}C, dG: {hairpin.dg:.1f}')
if hairpin.tm > annealing_temp - 10:
print(' WARNING: Hairpin may interfere with annealing')
# Homodimer
homodimer = primer3.calc_homodimer(primer_seq)
print(f'Homodimer Tm: {homodimer.tm:.1f}C, dG: {homodimer.dg:.1f}')
if homodimer.tm > 40:
print(' WARNING: Self-dimer potential')
# 3' end stability (last 5 bases)
end_3 = primer_seq[-5:]
end_gc = (end_3.count('G') + end_3.count('C'))
print(f"3' end (last 5bp): {end_3}, {end_gc} G/C bases")
if end_gc > 3:
print(" WARNING: 3' end may be too GC-rich")
if end_gc == 0:
print(" WARNING: 3' end lacks GC clamp")
# Poly-X runs
for base in 'ATGC':
for run_len in range(5, len(primer_seq)):
if base * run_len in primer_seq:
print(f' WARNING: Contains {base}x{run_len} run')
break
return {'tm': tm, 'gc': gc, 'hairpin_tm': hairpin.tm, 'homodimer_tm': homodimer.tm}
validate_primer('ATGCGATCGATCGATCGATC', 'Forward')
```
## Validate Primer Pair
```python
def validate_primer_pair(forward, reverse, annealing_temp=60.0):
'''Validate a primer pair'''
print(f'\n=== Primer Pair Validation ===')
print(f'Forward: {forward}')
print(f'Reverse: {reverse}')
# Individual primer checks
fwd_tm = primer3.calc_tm(forward)
rev_tm = primer3.calc_tm(reverse)
print(f'\nTm Forward: {fwd_tm:.1f}C')
print(f'Tm Reverse: {rev_tm:.1f}C')
print(f'Tm Difference: {abs(fwd_tm - rev_tm):.1f}C')
if abs(fwd_tm - rev_tm) > 2:
print(' WARNING: Tm difference > 2C')
# Heterodimer check
heterodimer = primer3.calc_heterodimer(forward, reverse)
print(f'\nHeterodimer Tm: {heterodimer.tm:.1f}C')
print(f'Heterodimer dG: {heterodimer.dg:.1f} cal/mol')
if heterodimer.tm > 40:
print(' WARNING: Significant primer dimer potential')
# Check 3' complementarity specifically
end_heterodimer = primer3.calc_heterodimer(forward[-6:], reverse[-6:])
print(f"3' end heterodimer Tm: {end_heterodimer.tm:.1f}C")
if end_heterodimer.tm > 20:
print(" WARNING: 3' ends may form stable dimer")
# Individual hairpins and homodimers
fwd_hairpin = primer3.calc_hairpin(forward)
rev_hairpin = primer3.calc_hairpin(reverse)
fwd_homodimer = primer3.calc_homodimer(forward)
rev_homodimer = primer3.calc_homodimer(reverse)
print(f'\nForward hairpin Tm: {fwd_hairpin.tm:.1f}C')
print(f'Reverse hairpin Tm: {rev_hairpin.tm:.1f}C')
print(f'Forward homodimer Tm: {fwd_homodimer.tm:.1f}C')
print(f'Reverse homodimer Tm: {rev_homodimer.tm:.1f}C')
return {
'fwd_tm': fwd_tm,
'rev_tm': rev_tm,
'heterodimer_tm': heterodimer.tm,
'fwd_hairpin_tm': fwd_hairpin.tm,
'rev_hairpin_tm': rev_hairpin.tm,
}
validate_primer_pair('ATGCGATCGATCGATCGATC', 'GCTAGCTAGCTAGCTAGCTA')
```
## Calculate End Stability (Native Function)
```python
# Use native calc_end_stability for 3' end thermodynamics
primer = 'ATGCGATCGATCGATCGATC'
# Calculate stability of last 5 bases (default)
end_stability = primer3.calc_end_stability(primer)
print(f"3' end stability: dG = {end_stability.dg:.1f} cal/mol")
# More negative dG = more stable 3' end = better extension but higher mispriming risk
if end_stability.dg < -9000:
print(' Note: Very stable 3\' end - good extension but watch for mispriming')
```
## Quick Tm-Only Checks (Lightweight)
```python
# For high-throughput screening, use Tm-only functions (return float, not ThermoResult)
primer = 'ATGCGATCGATCGATCGATC'
# Quick hairpin Tm check
hairpin_tm = primer3.calc_hairpin_tm(primer)
print(f'Hairpin Tm: {hairpin_tm:.1f}C')
# Quick homodimer Tm check
homodimer_tm = primer3.calc_homodimer_tm(primer)
print(f'Homodimer Tm: {homodimer_tm:.1f}C')
# Quick heterodimer Tm check
forward = 'ATGCGATCGATCGATCGATC'
reverse = 'GCTAGCTAGCTAGCTAGCTA'
heterodimer_tm = primer3.calc_heterodimer_tm(forward, reverse)
print(f'Heterodimer Tm: {heterodimer_tm:.1f}C')
```
## Fast Batch Screening with Tm-Only Functions
```python
def quick_screen_primers(primer_list, max_hairpin_tm=45, max_homodimer_tm=45):
'''Fast screening using Tm-only functions'''
passed = []
failed = []
for seq in primer_list:
hairpin_tm = primer3.calc_hairpin_tm(seq)
homodimer_tm = primer3.calc_homodimer_tm(seq)
if hairpin_tm < max_hairpin_tm and homodimer_tm < max_homodimer_tm:
passed.append(seq)
else:
failed.append((seq, hairpin_tm, homodimer_tm))
return passed, failed
primers = ['ATGCGATCGATCGATCGATC', 'GCGCGCGCGCGCGCGCGCGC', 'ATATATATATATATATATAT']
passed, failed = quick_screen_primers(primers)
print(f'Passed: {len(passed)}, Failed: {len(failed)}')
```
## Check Specificity (3' End)
```python
def check_3prime_specificity(primer_seq):
'''Check if 3' end is suitable for specific priming'''
end_5bp = primer_seq[-5:]
end_3bp = primer_seq[-3:]
# Count G/C in last 5 bases
gc_5 = end_5bp.count('G') + end_5bp.count('C')
# Check last base
last_base = primer_seq[-1]
print(f"3' sequence: ...{end_5bp}")
print(f"G/C in last 5bp: {gc_5}")
print(f"Last base: {last_base}")
# Ideal: 1-2 G/C in last 5, ending in G or C
if gc_5 == 0:
print(' Consider: No GC clamp at 3\' end')
elif gc_5 > 3:
print(' Consider: 3\' end may be too stable (mispriming risk)')
if last_base in 'AT':
print(' Consider: Ending in A/T may reduce specificity')
return {'gc_5': gc_5, 'last_base': last_base}
check_3prime_specificity('ATGCGATCGATCGATCGATC')
```
## Batch Validation
```python
import pandas as pd
def batch_validate_primers(primers):
'''Validate multiple primers'''
results = []
for name, seq in primers.items():
tm = primer3.calc_tm(seq)
gc = (seq.count('G') + seq.count('C')) / len(seq) * 100
hairpin = primer3.calc_hairpin(seq)
homodimer = primer3.calc_homodimer(seq)
results.append({
'name': name,
'sequence': seq,
'length': len(seq),
'tm': round(tm, 1),
'gc_pct': round(gc, 1),
'hairpin_tm': round(hairpin.tm, 1),
'homodimer_tm': round(homodimer.tm, 1),
})
return pd.DataFrame(results)
primers = {
'GAPDH_F': 'GTCTCCTCTGACTTCAACAGCG',
'GAPDH_R': 'ACCACCCTGTTGCTGTAGCCAA',
'ACTB_F': 'CATGTACGTTGCTATCCAGGC',
'ACTB_R': 'CTCCTTAATGTCACGCACGAT',
}
df = batch_validate_primers(primers)
print(df.to_string(index=False))
```
## Thermodynamic Parameters Under Different Conditions
```python
primer = 'ATGCGATCGATCGATCGATC'
# Standard conditions
tm_standard = primer3.calc_tm(primer)
hairpin_standard = primer3.calc_hairpin(primer)
# Custom salt conditions
tm_custom = primer3.calc_tm(primer, mv_conc=100.0, dv_conc=2.0, dntp_conc=0.4, dna_conc=200.0)
hairpin_custom = primer3.calc_hairpin(primer, mv_conc=100.0, dv_conc=2.0)
print(f'Standard conditions: Tm={tm_standard:.1f}C, Hairpin Tm={hairpin_standard.tm:.1f}C')
print(f'Custom conditions: Tm={tm_custom:.1f}C, Hairpin Tm={hairpin_custom.tm:.1f}C')
```
## Validation Thresholds
| Property | Acceptable | Optimal |
|----------|------------|---------|
| Length | 18-30 bp | 20-25 bp |
| Tm | 55-65C | 58-62C |
| GC% | 35-65% | 45-55% |
| Hairpin Tm | <45C | <35C |
| Homodimer Tm | <45C | <35C |
| Heterodimer Tm | <45C | <35C |
| 3' GC (last 5bp) | 1-3 | 2 |
## Related Skills
- primer-basics - Design new primers with primer3
- qpcr-primers - Design and validate qPCR assays
- database-access/local-blast - BLAST primers against genome for specificity
<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.
No comments yet. Be the first to comment!