Skills DirectorySkills Directory
SkillsLearnSecurityCategoriesDocsCommunityBlog
Sign InSubmit Skill
Skills Directory

Security-tested agent skills for Claude, coding agents, and AI workflows.

Directory

  • Browse Skills
  • All Skills A–Z
  • Claude Skills
  • Claude Code Skills
  • Agent Skills
  • Categories
  • Submit a Skill

Learn

  • Learn Hub
  • Install Claude Skills
  • Write SKILL.md
  • Skills vs MCP
  • Directories Compared

Security

  • Security
  • Methodology
  • Secure Claude Skills
  • Security Badges

Company

  • About
  • Community
  • Blog
  • API Docs
  • Advertise

2026 Skills Directory. All rights reserved.

Back to skills

Tooluniverse Sequence Retrieval

ASecurity

Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.

2,984 stars
0 votes
0 copies
0 views
Added 5/29/2026
ai-agentspythongoapidatabase

Works with

api

Security Analysis

A100/100

Scanned 5/29/2026

Install to Claude Code

$npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill tooluniverse-sequence-retrieval --agent claude-code

Installs into .claude/skills of the current project.

Are you the author of Tooluniverse Sequence Retrieval?

Add the live security badge to your README — it updates automatically with every re-scan.

Security grade badge for Tooluniverse Sequence Retrieval
[![Security: A — Skills Directory](https://www.skillsdirectory.com/api/skills/freedomintelligence-tooluniverse-sequence-retrieval/badge)](https://www.skillsdirectory.com/skills/freedomintelligence-tooluniverse-sequence-retrieval)

More formats (shields.io, HTML) on the badges page.

Download Zip
Files
SKILL.md
---
name: tooluniverse-sequence-retrieval
description: Retrieves biological sequences (DNA, RNA, protein) from NCBI and ENA with gene disambiguation, accession type handling, and comprehensive sequence profiles. Creates detailed reports with sequence metadata, cross-database references, and download options. Use when users need nucleotide sequences, protein sequences, genome data, or mention GenBank, RefSeq, EMBL accessions.
---

# Biological Sequence Retrieval

Retrieve DNA, RNA, and protein sequences with proper disambiguation and cross-database handling.

**IMPORTANT**: Always use English terms in tool calls (gene names, organism names, sequence descriptions), even if the user writes in another language. Only try original-language terms as a fallback if English returns no results. Respond in the user's language.

## Workflow Overview

```
Phase 0: Clarify (if needed)
    ↓
Phase 1: Disambiguate Gene/Organism
    ↓
Phase 2: Search & Retrieve (Internal)
    ↓
Phase 3: Report Sequence Profile
```

---

## Phase 0: Clarification (When Needed)

Ask the user ONLY if:
- Gene name exists in multiple organisms (e.g., "BRCA1" → human or mouse?)
- Sequence type unclear (mRNA, genomic, protein?)
- Strain/isolate matters (e.g., E. coli → K-12, O157:H7, etc.)

Skip clarification for:
- Specific accession numbers (NC_*, NM_*, U*, etc.)
- Clear organism + gene combinations
- Complete genome requests with organism specified

---

## Phase 1: Gene/Organism Disambiguation

### 1.1 Resolve Identifiers

```python
from tooluniverse import ToolUniverse
tu = ToolUniverse()
tu.load_tools()

# Strategy depends on input type
if user_provided_accession:
    # Direct retrieval based on accession type
    accession = user_provided_accession
    
elif user_provided_gene_and_organism:
    # Search NCBI Nucleotide
    result = tu.tools.NCBI_search_nucleotide(
        operation="search",
        organism=organism,
        gene=gene,
        limit=10
    )
```

### 1.2 Accession Type Decision Tree

**CRITICAL**: Accession prefix determines which tools to use.

| Prefix | Type | Use With |
|--------|------|----------|
| NC_* | RefSeq chromosome | NCBI only |
| NM_* | RefSeq mRNA | NCBI only |
| NR_* | RefSeq ncRNA | NCBI only |
| NP_* | RefSeq protein | NCBI only |
| XM_* | RefSeq predicted mRNA | NCBI only |
| U*, M*, K*, X* | GenBank | NCBI or ENA |
| CP*, NZ_* | GenBank genome | NCBI or ENA |
| EMBL format | EMBL | ENA preferred |

### 1.3 Identity Resolution Checklist

- [ ] Organism confirmed (scientific name)
- [ ] Gene symbol/name identified
- [ ] Sequence type determined (genomic/mRNA/protein)
- [ ] Strain specified (if relevant)
- [ ] Accession prefix identified → tool selection

---

## Phase 2: Data Retrieval (Internal)

Retrieve silently. Do NOT narrate the search process.

### 2.1 Search for Sequences

```python
# Search NCBI Nucleotide
result = tu.tools.NCBI_search_nucleotide(
    operation="search",
    organism=organism,
    gene=gene,
    strain=strain,  # Optional
    keywords=keywords,  # Optional
    seq_type=seq_type,  # complete_genome, mrna, refseq
    limit=10
)

# Get accession numbers from UIDs
accessions = tu.tools.NCBI_fetch_accessions(
    operation="fetch_accession",
    uids=result["data"]["uids"]
)
```

### 2.2 Retrieve Sequence Data

```python
# Get sequence in desired format
sequence = tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession=accession,
    format="fasta"  # or "genbank"
)

# GenBank format for annotations
annotations = tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession=accession,
    format="genbank"
)
```

### 2.3 ENA Alternative (for GenBank/EMBL accessions)

```python
# Only for non-RefSeq accessions!
if not accession.startswith(("NC_", "NM_", "NR_", "NP_", "XM_", "XR_")):
    # ENA entry info
    entry = tu.tools.ena_get_entry(accession=accession)
    
    # ENA FASTA
    fasta = tu.tools.ena_get_sequence_fasta(accession=accession)
    
    # ENA summary
    summary = tu.tools.ena_get_entry_summary(accession=accession)
```

### Fallback Chains

| Primary | Fallback | Notes |
|---------|----------|-------|
| NCBI_get_sequence | ENA (if GenBank format) | NCBI unavailable |
| ENA_get_entry | NCBI_get_sequence | ENA doesn't have RefSeq |
| NCBI_search_nucleotide | Try broader keywords | No results |

**Critical Rule**: Never try ENA tools with RefSeq accessions (NC_, NM_, etc.) - they will return 404 errors.

---

## Phase 3: Report Sequence Profile

### Output Structure

Present as a **Sequence Profile Report**. Hide search process.

```markdown
# Sequence Profile: [Gene/Organism]

**Search Summary**
- Query: [gene] in [organism]
- Database: NCBI Nucleotide
- Results: [N] sequences found

---

## Primary Sequence

### [Accession]: [Definition/Title]

| Attribute | Value |
|-----------|-------|
| **Accession** | [accession] |
| **Type** | RefSeq / GenBank |
| **Organism** | [scientific name] |
| **Strain** | [strain if applicable] |
| **Length** | [X,XXX bp / aa] |
| **Molecule** | DNA / mRNA / Protein |
| **Topology** | Linear / Circular |

**Curation Level**: ●●● RefSeq (curated) / ●●○ GenBank (submitted) / ●○○ Third-party

### Sequence Statistics
| Statistic | Value |
|-----------|-------|
| **Length** | [X,XXX] bp |
| **GC Content** | [XX.X]% |
| **Genes** | [N] (if genome) |
| **CDS** | [N] (if annotated) |

### Sequence Preview
```fasta
>[accession] [definition]
ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA
... [truncated, full sequence in download]
```

### Annotations Summary (from GenBank format)
| Feature | Count | Examples |
|---------|-------|----------|
| CDS | [N] | [gene names] |
| tRNA | [N] | - |
| rRNA | [N] | 16S, 23S |
| Regulatory | [N] | promoters |

---

## Alternative Sequences

Ranked by relevance and curation level:

| Accession | Type | Length | Description | ENA Compatible |
|-----------|------|--------|-------------|----------------|
| NC_000913.3 | RefSeq | 4.6 Mb | E. coli K-12 reference | ✗ |
| U00096.3 | GenBank | 4.6 Mb | E. coli K-12 | ✓ |
| CP001509.3 | GenBank | 4.6 Mb | E. coli DH10B | ✓ |

---

## Cross-Database References

| Database | Accession | Link |
|----------|-----------|------|
| RefSeq | [NC_*] | [NCBI link] |
| GenBank | [U*] | [NCBI link] |
| ENA/EMBL | [same as GenBank] | [ENA link] |
| BioProject | [PRJNA*] | [link] |
| BioSample | [SAMN*] | [link] |

---

## Download Options

### Formats Available
| Format | Description | Use Case |
|--------|-------------|----------|
| FASTA | Sequence only | BLAST, alignment |
| GenBank | Sequence + annotations | Gene analysis |
| GFF3 | Annotations only | Genome browsers |

### Direct Commands
```python
# FASTA format
tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession="[accession]",
    format="fasta"
)

# GenBank format (with annotations)
tu.tools.NCBI_get_sequence(
    operation="fetch_sequence",
    accession="[accession]",
    format="genbank"
)
```

---

## Related Sequences

### Other Strains/Isolates
| Accession | Strain | Similarity | Notes |
|-----------|--------|------------|-------|
| [acc1] | [strain1] | 99.9% | [notes] |
| [acc2] | [strain2] | 99.5% | [notes] |

### Protein Products (if applicable)
| Protein Accession | Product Name | Length |
|-------------------|--------------|--------|
| [NP_*] | [protein name] | [X] aa |

---

Retrieved: [date]
Database: NCBI Nucleotide
```

---

## Curation Level Tiers

| Tier | Symbol | Accession Prefix | Description |
|------|--------|------------------|-------------|
| RefSeq Reference | ●●●● | NC_, NM_, NP_ | NCBI-curated, gold standard |
| RefSeq Predicted | ●●●○ | XM_, XP_, XR_ | Computationally predicted |
| GenBank Validated | ●●○○ | Various | Submitted, some curation |
| GenBank Direct | ●○○○ | Various | Direct submission |
| Third Party | ○○○○ | TPA_ | Third-party annotation |

Include in report:
```markdown
**Curation Level**: ●●●● RefSeq Reference
- Curated by NCBI RefSeq project
- Regular updates and validation
- Recommended for reference use
```

---

## Completeness Checklist

Every sequence report MUST include:

### Per Sequence (Required)
- [ ] Accession number
- [ ] Organism (scientific name)
- [ ] Sequence type (DNA/RNA/protein)
- [ ] Length
- [ ] Curation level
- [ ] Database source

### Search Summary (Required)
- [ ] Query parameters
- [ ] Number of results
- [ ] Ranking rationale

### Include Even If Limited
- [ ] Alternative sequences (or "Only one sequence found")
- [ ] Cross-database references (or "No cross-references available")
- [ ] Download instructions

---

## Common Use Cases

### Reference Genome
User: "Get E. coli K-12 complete genome"
```python
result = tu.tools.NCBI_search_nucleotide(
    operation="search",
    organism="Escherichia coli",
    strain="K-12",
    seq_type="complete_genome",
    limit=3
)
# Return NC_000913.3 (RefSeq reference)
```

### Gene Sequence
User: "Find human BRCA1 mRNA"
```python
result = tu.tools.NCBI_search_nucleotide(
    operation="search",
    organism="Homo sapiens",
    gene="BRCA1",
    seq_type="mrna",
    limit=10
)
```

### Specific Accession
User: "Get sequence for NC_045512.2"
→ Direct retrieval with full metadata

### Strain Comparison
User: "Compare E. coli K-12 and O157:H7 genomes"
→ Search both strains, provide comparison table

---

## Error Handling

| Error | Response |
|-------|----------|
| "No search criteria provided" | Add organism, gene, or keywords |
| "ENA 404 error" | Accession is likely RefSeq → use NCBI only |
| "No results found" | Broaden search, check spelling, try synonyms |
| "Sequence too large" | Note size, provide download link instead of preview |
| "API rate limit" | Tools auto-retry; if persistent, wait briefly |

---

## Tool Reference

**NCBI Tools (All Accessions)**
| Tool | Purpose |
|------|---------|
| `NCBI_search_nucleotide` | Search by gene/organism |
| `NCBI_fetch_accessions` | Convert UIDs to accessions |
| `NCBI_get_sequence` | Retrieve sequence data |

**ENA Tools (GenBank/EMBL Only)**
| Tool | Purpose |
|------|---------|
| `ena_get_entry` | Entry metadata |
| `ena_get_sequence_fasta` | FASTA sequence |
| `ena_get_entry_summary` | Summary info |

---

## Search Parameters Reference

**NCBI_search_nucleotide**
| Parameter | Description | Example |
|-----------|-------------|---------|
| `operation` | Always "search" | "search" |
| `organism` | Scientific name | "Homo sapiens" |
| `gene` | Gene symbol | "BRCA1" |
| `strain` | Specific strain | "K-12" |
| `keywords` | Free text | "complete genome" |
| `seq_type` | Sequence type | "complete_genome", "mrna", "refseq" |
| `limit` | Max results | 10 |

**NCBI_get_sequence**
| Parameter | Description | Example |
|-----------|-------------|---------|
| `operation` | Always "fetch_sequence" | "fetch_sequence" |
| `accession` | Accession number | "NC_000913.3" |
| `format` | Output format | "fasta", "genbank" |

Attribution

FreedomIntelligenceFreedomIntelligence
View sourceMore from FreedomIntelligence →
SSkills DirectorySkills Directory

Ship a skill? Prove it's safe.

Free 120-pattern security scan, letter grade, and an embeddable README badge.

Submit a skill

Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.

Comments (0)

No comments yet. Be the first to comment!

SSkills DirectorySkills Directory

Ship a skill? Prove it's safe.

Free 120-pattern security scan, letter grade, and an embeddable README badge.

Submit a skill

Related Skills

Caveman

Ultra-compressed communication mode. Cuts token usage ~75% by speaking like caveman while keeping full technical accuracy. Supports intensity levels: lite, full (default), ultra, wenyan-lite, wenyan-full, wenyan-ultra. Use when user says "caveman mode", "talk like caveman", "use caveman", "less tokens", "be brief", or invokes /caveman. Also auto-triggers when token efficiency is requested.

1023331 votes

Hyperplan

Adversarial multi-agent planning skill. Self-orchestrates 5 hostile category members (unspecified-low, unspecified-high, deep, ultrabrain, artistry) via team-mode for ruthless cross-critique debate, distills only the defensible insights, then MANDATORILY hands the distilled insight bundle to the `plan` agent for executable plan formalization. Use when planning needs maximum rigor and surfacing of weak assumptions, blind spots, and over-engineering. Triggers: 'hyperplan', 'hpp', '/hyperplan', ...

686011 votes

Mcp Code Execution

Routes multi-tool workflows through MCP servers for large datasets and pipelines. Use when Bash tool overhead is limiting throughput on data-heavy tasks.

3331 votes

catchup

Recovers prior coding-agent session context by running `catchup <agent> --since-compact`, which extracts a clean summary of a previous Codex, Claude Code, Antigravity, OpenCode, or Pi Agent session. Use when the user says "catch up", "what did the last session do", "get me up to speed", "I switched agents", or asks to recover/summarize a previous session before continuing. Do NOT use for the current conversation, git history, or any non-agent log.

611 votes

math-skill

A comprehensive mathematical reasoning skill for AI assistants — handles arithmetic to research-level problems with rigorous step-by-step reasoning, systematic verification, and transparent uncertainty handling

381 votes
View all in ai-agents →