Skills DirectorySkills Directory
SkillsLearnSecurityCategoriesDocsCommunityBlog
Sign InSubmit Skill
Skills Directory

Security-tested agent skills for Claude, coding agents, and AI workflows.

Directory

  • Browse Skills
  • All Skills A–Z
  • Claude Skills
  • Claude Code Skills
  • Agent Skills
  • Categories
  • Submit a Skill

Learn

  • Learn Hub
  • Install Claude Skills
  • Write SKILL.md
  • Skills vs MCP
  • Directories Compared

Security

  • Security
  • Methodology
  • Secure Claude Skills
  • Security Badges

Company

  • About
  • Community
  • Blog
  • API Docs
  • Advertise

2026 Skills Directory. All rights reserved.

Back to skills

Bio Workflows Smrna Pipeline

ASecurity

--> --- name: bio-workflows-smrna-pipeline description: End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data. tool_type: mixed primary_tool: miRDeep2 measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command ---

2,984 stars
0 votes
0 copies
0 views
Added 5/30/2026
toolsshellbashexpress

Security Analysis

A100/100

Scanned 5/30/2026

Install to Claude Code

$npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-workflows-smrna-pipeline --agent claude-code

Installs into .claude/skills of the current project.

Are you the author of Bio Workflows Smrna Pipeline?

Add the live security badge to your README — it updates automatically with every re-scan.

Security grade badge for Bio Workflows Smrna Pipeline
[![Security: A — Skills Directory](https://www.skillsdirectory.com/api/skills/freedomintelligence-bio-workflows-smrna-pipeline/badge)](https://www.skillsdirectory.com/skills/freedomintelligence-bio-workflows-smrna-pipeline)

More formats (shields.io, HTML) on the badges page.

Download Zip
Files
SKILL.md
<!--
# COPYRIGHT NOTICE
# This file is part of the "Universal Biomedical Skills" project.
# Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu>
# All Rights Reserved.
#
# This code is proprietary and confidential.
# Unauthorized copying of this file, via any medium is strictly prohibited.
#
# Provenance: Authenticated by MD BABU MIA

-->

---
name: bio-workflows-smrna-pipeline
description: End-to-end small RNA-seq analysis from FASTQ to differential miRNA expression. Use when analyzing miRNA, piRNA, or other small RNA sequencing data.
tool_type: mixed
primary_tool: miRDeep2
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
  - read_file
  - run_shell_command
---

# Small RNA-seq Pipeline

## Pipeline Overview

```
FASTQ → cutadapt trim → miRDeep2 → Quantification → DESeq2 → Target prediction
```

## Step 1: Preprocessing

```bash
# Adapter trimming and size selection
cutadapt -a TGGAATTCTCGGGTGCCAAGG \
    --minimum-length 18 --maximum-length 30 \
    -o trimmed.fastq.gz reads.fastq.gz
```

## Step 2: miRDeep2 Analysis

```bash
# Align to genome
mapper.pl trimmed.fastq.gz -e -h -i -j -l 18 \
    -m -p genome_index -s reads_collapsed.fa \
    -t reads_collapsed_vs_genome.arf

# miRNA quantification and novel prediction
miRDeep2.pl reads_collapsed.fa genome.fa \
    reads_collapsed_vs_genome.arf \
    mature_ref.fa none hairpin_ref.fa
```

## Step 3: Differential Expression

```r
library(DESeq2)
counts <- read.csv('mirna_counts.csv', row.names = 1)
dds <- DESeqDataSetFromMatrix(counts, colData, ~condition)
dds <- DESeq(dds)
results <- results(dds)
```

## Step 4: Target Prediction

```bash
# miRanda for target prediction
miranda mature_mirnas.fa target_3utrs.fa -out targets.txt
```

## QC Checkpoints

1. **After trimming**: Size distribution should peak at 21-23nt
2. **After alignment**: >70% mapping rate expected
3. **After DE**: Check volcano plot and PCA

## Related Skills

- small-rna-seq/mirdeep2-analysis - Detailed miRDeep2
- small-rna-seq/differential-mirna - DE analysis
- small-rna-seq/target-prediction - Target analysis


<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->

Attribution

FreedomIntelligenceFreedomIntelligence
View sourceMore from FreedomIntelligence →
SSkills DirectorySkills Directory

Ship a skill? Prove it's safe.

Free 120-pattern security scan, letter grade, and an embeddable README badge.

Submit a skill

Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.

Comments (0)

No comments yet. Be the first to comment!

SSkills DirectorySkills Directory

Ship a skill? Prove it's safe.

Free 120-pattern security scan, letter grade, and an embeddable README badge.

Submit a skill

Related Skills

ucoz-landing-skill

Playbook for creating and editing uCoz landing pages via MCP tools (`templates_tool`, `ftp_tool`, `modules_tool`). Use for tasks such as: "build a landing page", "update the homepage as a landing page", "create a promo page on the homepage", "add a lead form / menu / SEO to the homepage". Homepage: `page_list`, `page_get`; first publish — `page_update` with full `page_tmpl`; HTML edits after generation — `patch_template` (module_id=2, template_id=1), not `update_template`. Activate the mail f...

107 votes

Paperclip

Interact with the Paperclip control plane API to manage tasks, coordinate with other agents, and follow company governance. Use when you need to check assignments, update task status, delegate work, post comments, set up or manage routines (recurring scheduled tasks), or call any Paperclip API endpoint. Do NOT use for the actual domain work itself (writing code, research, etc.) — only for Paperclip coordination.

798221 votes

Daw Music

Digital Audio Workstation usage, music composition, interactive music systems, and game audio implementation for immersive soundscapes.

761 votes

Instantly Rdsthomas Mission Control

Instantly.ai cold email outreach API - manage campaigns, leads, accounts, and analytics. Use for cold email automation, lead management, campaign creation/monitoring, and email account warmup.

761 votes

Caveman Compress

Compress natural language memory files (CLAUDE.md, todos, preferences) into caveman format to save input tokens. Preserves all technical substance, code, URLs, and structure. Compressed version overwrites the original file. Human-readable backup saved as FILE.original.md. Trigger: /caveman-compress FILEPATH or "compress memory file"

1023330 votes
View all in tools →