Skills DirectorySkills Directory
SkillsLearnSecurityCategoriesDocsCommunityBlog
Sign InSubmit Skill
Skills Directory

Security-tested agent skills for Claude, coding agents, and AI workflows.

Directory

  • Browse Skills
  • All Skills A–Z
  • Claude Skills
  • Claude Code Skills
  • Agent Skills
  • Categories
  • Submit a Skill

Learn

  • Learn Hub
  • Install Claude Skills
  • Write SKILL.md
  • Skills vs MCP
  • Directories Compared

Security

  • Security
  • Methodology
  • Secure Claude Skills
  • Security Badges

Company

  • About
  • Community
  • Blog
  • API Docs
  • Advertise

2026 Skills Directory. All rights reserved.

Back to skills

Bio Read Qc Adapter Trimming

ASecurity

Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.

2,984 stars
0 votes
0 copies
0 views
Added 5/29/2026
ai-agentsbashapiperformance

Works with

cliapi

Security Analysis

A100/100

Scanned 5/29/2026

Install to Claude Code

$npx -y skills add FreedomIntelligence/OpenClaw-Medical-Skills --skill bio-read-qc-adapter-trimming --agent claude-code

Installs into .claude/skills of the current project.

Are you the author of Bio Read Qc Adapter Trimming?

Add the live security badge to your README — it updates automatically with every re-scan.

Security grade badge for Bio Read Qc Adapter Trimming
[![Security: A — Skills Directory](https://www.skillsdirectory.com/api/skills/freedomintelligence-bio-read-qc-adapter-trimming/badge)](https://www.skillsdirectory.com/skills/freedomintelligence-bio-read-qc-adapter-trimming)

More formats (shields.io, HTML) on the badges page.

Download Zip
Files
SKILL.md
---
name: bio-read-qc-adapter-trimming
description: Remove sequencing adapters from FASTQ files using Cutadapt and Trimmomatic. Supports single-end and paired-end reads, Illumina TruSeq, Nextera, and custom adapter sequences. Use when FastQC shows adapter contamination or before alignment of short reads.
tool_type: cli
primary_tool: cutadapt
---

## Version Compatibility

Reference examples tested with: FastQC 0.12+, Trimmomatic 0.39+, cutadapt 4.4+, fastp 0.23+

Before using code patterns, verify installed versions match. If versions differ:
- CLI: `<tool> --version` then `<tool> --help` to confirm flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.

# Adapter Trimming

Remove sequencing adapters from reads using Cutadapt (precise, flexible) or Trimmomatic (paired-end optimized).

**"Trim adapters from reads"** → Remove sequencing adapter sequences from FASTQ reads to prevent adapter contamination in downstream alignment.
- CLI: `cutadapt -a ADAPTER -o out.fq in.fq` or `trimmomatic PE` with ILLUMINACLIP
- CLI: `fastp -i in.fq -o out.fq` (auto-detects adapters)

## Common Adapter Sequences

| Platform/Kit | Adapter | Sequence |
|--------------|---------|----------|
| Illumina TruSeq | Read 1 3' | AGATCGGAAGAGCACACGTCTGAACTCCAGTCA |
| Illumina TruSeq | Read 2 3' | AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT |
| Nextera | Transposase | CTGTCTCTTATACACATCT |
| Small RNA | 3' adapter | TGGAATTCTCGGGTGCCAAGG |
| Poly-A | Poly-A tail | AAAAAAAAAAAAAAAA |

## Cutadapt

### Single-End Reads

```bash
# 3' adapter (most common)
cutadapt -a AGATCGGAAGAGC -o trimmed.fastq.gz sample.fastq.gz

# 5' adapter
cutadapt -g ACGTACGT -o trimmed.fastq.gz sample.fastq.gz

# Both ends
cutadapt -a ADAPTER1 -g ADAPTER2 -o trimmed.fastq.gz sample.fastq.gz

# Multiple adapters (tries each)
cutadapt -a ADAPTER1 -a ADAPTER2 -a ADAPTER3 -o trimmed.fastq.gz sample.fastq.gz
```

### Paired-End Reads

```bash
# Basic paired-end
cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCA \
         -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         sample_R1.fastq.gz sample_R2.fastq.gz

# Short form for Illumina TruSeq (auto-detect)
cutadapt -a AGATCGGAAGAGC -A AGATCGGAAGAGC \
         -o trimmed_R1.fastq.gz -p trimmed_R2.fastq.gz \
         sample_R1.fastq.gz sample_R2.fastq.gz
```

### Adapter Options

```bash
# Error rate (default 0.1 = 10% mismatches allowed)
cutadapt -a ADAPTER -e 0.15 -o out.fq in.fq

# Minimum overlap (default 3)
cutadapt -a ADAPTER -O 5 -o out.fq in.fq

# No indels in adapter alignment
cutadapt -a ADAPTER --no-indels -o out.fq in.fq

# Trim Ns from ends
cutadapt --trim-n -o out.fq in.fq

# Anchored adapters (must be at end)
cutadapt -a ADAPTER$ -o out.fq in.fq
```

### Linked Adapters

```bash
# 5' adapter followed by 3' adapter (same read)
cutadapt -a ADAPTER1...ADAPTER2 -o out.fq in.fq

# Anchored 5' linked to 3'
cutadapt -a ^ADAPTER1...ADAPTER2 -o out.fq in.fq
```

### Filtering After Trimming

```bash
# Minimum length (discard shorter)
cutadapt -a ADAPTER -m 20 -o out.fq in.fq

# Maximum length
cutadapt -a ADAPTER -M 150 -o out.fq in.fq

# Maximum N content
cutadapt -a ADAPTER --max-n 0.1 -o out.fq in.fq

# Discard trimmed reads
cutadapt -a ADAPTER --discard-trimmed -o out.fq in.fq

# Discard untrimmed reads
cutadapt -a ADAPTER --discard-untrimmed -o out.fq in.fq
```

### Paired-End Filtering

```bash
# Both reads must pass minimum length
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
         -o R1.fq -p R2.fq in_R1.fq in_R2.fq

# Output too-short reads separately
cutadapt -a ADAPT1 -A ADAPT2 -m 20 \
         --too-short-output short_R1.fq --too-short-paired-output short_R2.fq \
         -o R1.fq -p R2.fq in_R1.fq in_R2.fq
```

### Action Options

```bash
# Mask adapter instead of trim (replace with N)
cutadapt -a ADAPTER --action=mask -o out.fq in.fq

# Retain adapter but lowercase
cutadapt -a ADAPTER --action=lowercase -o out.fq in.fq

# Just find adapters, don't modify
cutadapt -a ADAPTER --action=none -o out.fq in.fq
```

## Trimmomatic

### Single-End Mode

```bash
trimmomatic SE -phred33 \
    input.fastq.gz output.fastq.gz \
    ILLUMINACLIP:adapters.fa:2:30:10
```

### Paired-End Mode

```bash
trimmomatic PE -phred33 -threads 4 \
    input_R1.fastq.gz input_R2.fastq.gz \
    output_R1_paired.fastq.gz output_R1_unpaired.fastq.gz \
    output_R2_paired.fastq.gz output_R2_unpaired.fastq.gz \
    ILLUMINACLIP:TruSeq3-PE-2.fa:2:30:10
```

### ILLUMINACLIP Parameters

```bash
ILLUMINACLIP:<fastaWithAdapters>:<seed>:<palindrome>:<simple>

# Parameters:
# seed - max mismatches in 16bp seed (usually 2)
# palindrome - threshold for palindrome match (usually 30)
# simple - threshold for simple match (usually 10)

# Example with all options
ILLUMINACLIP:adapters.fa:2:30:10:2:keepBothReads
```

### Built-in Adapter Files

Trimmomatic includes adapter files:
- `TruSeq2-SE.fa` - TruSeq v2 single-end
- `TruSeq2-PE.fa` - TruSeq v2 paired-end
- `TruSeq3-SE.fa` - TruSeq v3 single-end
- `TruSeq3-PE.fa` - TruSeq v3 paired-end
- `TruSeq3-PE-2.fa` - TruSeq v3 PE (palindrome mode)
- `NexteraPE-PE.fa` - Nextera paired-end

### Find Trimmomatic Adapters

```bash
# Find adapter directory
TRIMMOMATIC_JAR=$(which trimmomatic | xargs dirname)/../share/trimmomatic-*/adapters/

# Or with conda
ls $CONDA_PREFIX/share/trimmomatic-*/adapters/
```

## Performance

```bash
# Cutadapt with multiple cores
cutadapt -j 8 -a ADAPTER -o out.fq in.fq

# Trimmomatic threads
trimmomatic PE -threads 8 ...
```

## Verify Trimming

```bash
# Check adapter removal with FastQC
fastqc trimmed.fastq.gz

# Count reads before/after
zcat input.fastq.gz | wc -l
zcat trimmed.fastq.gz | wc -l
```

## Related Skills

- quality-reports - Check adapter content with FastQC
- quality-filtering - Quality trimming after adapter removal
- fastp-workflow - Combined adapter and quality trimming

Attribution

FreedomIntelligenceFreedomIntelligence
View sourceMore from FreedomIntelligence →
SSkills DirectorySkills Directory

Your tool, in front of Claude Code builders.

3 founder slots · $299/mo · GSC-verified traffic · sponsors can never buy grades.

See placements

Is this your skill, or is something wrong with this listing? Request removal or report an issue. Author removals are honored within 72 hours.

Comments (0)

No comments yet. Be the first to comment!

SSkills DirectorySkills Directory

Your tool, in front of Claude Code builders.

3 founder slots · $299/mo · GSC-verified traffic · sponsors can never buy grades.

See placements

Related Skills

Caveman

Ultra-compressed communication mode. Cuts token usage ~75% by speaking like caveman while keeping full technical accuracy. Supports intensity levels: lite, full (default), ultra, wenyan-lite, wenyan-full, wenyan-ultra. Use when user says "caveman mode", "talk like caveman", "use caveman", "less tokens", "be brief", or invokes /caveman. Also auto-triggers when token efficiency is requested.

1023331 votes

Hyperplan

Adversarial multi-agent planning skill. Self-orchestrates 5 hostile category members (unspecified-low, unspecified-high, deep, ultrabrain, artistry) via team-mode for ruthless cross-critique debate, distills only the defensible insights, then MANDATORILY hands the distilled insight bundle to the `plan` agent for executable plan formalization. Use when planning needs maximum rigor and surfacing of weak assumptions, blind spots, and over-engineering. Triggers: 'hyperplan', 'hpp', '/hyperplan', ...

686011 votes

Mcp Code Execution

Routes multi-tool workflows through MCP servers for large datasets and pipelines. Use when Bash tool overhead is limiting throughput on data-heavy tasks.

3351 votes

catchup

Recovers prior coding-agent session context by running `catchup <agent> --since-compact`, which extracts a clean summary of a previous Codex, Claude Code, Antigravity, OpenCode, or Pi Agent session. Use when the user says "catch up", "what did the last session do", "get me up to speed", "I switched agents", or asks to recover/summarize a previous session before continuing. Do NOT use for the current conversation, git history, or any non-agent log.

611 votes

math-skill

A comprehensive mathematical reasoning skill for AI assistants — handles arithmetic to research-level problems with rigorous step-by-step reasoning, systematic verification, and transparent uncertainty handling

381 votes
View all in ai-agents →